Gene/Protein Characteristic Table for KIAA1026
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00716
Accession No AB028949
Description kazrin, periplakin interacting protein
Clone name fh00114
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5592 bp)
Predicted protein sequence (519 aa)
Source Human fetal brain
Rouge ID mKIAA1026 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5592 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 4032 bp
Genome contig ID gi89161185f_14697865
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTTTTTAAATTGCATTGCCGTTTCTTTCTTTATG
Flanking genome sequence
(567780 - 567829)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAGAAAAAAAGAAAATTGTTTCATTTAATTTATTTGCACAAATG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 f 14797787 15265643 7 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 519 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG09940 1.1e-125 100.0 kazrin protein ...
synthetic construct
AAS86434 3.6e-100 97.3 kazrin isoform ...
Homo sapiens
Q674X7 5.5e-100 97.3 Kazrin.
Homo sapiens
Q5FWS6 5e-94 92.2 Kazrin.
Rattus norvegicus
NP_001103154 1.6e-93 92.2 kazrin isoform ...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCCCCATCAATAAGCCATCTG
Primer_r ATAGGGTTGTGCAGGTTCTTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp