Order Kazusa clone(s) from : ![]() |
Product ID | ORK01621 |
---|---|
Accession No | AB023218 |
Description | arylsulfatase G, transcript variant 1 |
Clone name | hk09652 |
Vector information | |
cDNA sequence | DNA sequence (4304 bp) Predicted protein sequence (551 aa) |
HaloTag ORF Clone |
FHC01621
![]() |
Flexi ORF Clone | FXC01621 |
Source | Human adult brain |
Rouge ID |
mKIAA1001
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 63814772 | 63930467 | 11 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000917 | 60 | 419 | PF00884 | Sulphatase |
ScanRegExp | IPR000917 | 108 | 120 | PS00523 | Sulphatase |
IPR000917 | 155 | 165 | PS00149 | Sulphatase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 29 | WLFLKVLLAGVSFSGFLYPLVDF | 51 | PRIMARY | 23 |
---|
![]() |
Primer_f | GAAAGAGGTGGTGCGGAGTAC |
---|---|
Primer_r | TGACAGCGGCAGGCAATTTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |