KIAA0969

Product ID	ORK00703
Accession No	AB023186
Description	pleckstrin homology domain containing, family A member 6
Clone name	hj06525
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5047 bp) Predicted protein sequence (1091 aa)
HaloTag ORF Clone	FHC00703
Flexi ORF Clone	FXC00703
Source	Human adult brain
Rouge ID	mKIAA0969 by Kazusa Mouse cDNA Project

Length: 5047 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1583 bp
Genome contig ID	gi89161185r_202356972
PolyA signal sequence (AGTAAA,-24)	+--------+--------+----*----+---- GTTCATATGCAAGTAAAGATGACAATTTACTCAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATTTATCGAGCACCTTTTATGTACCAGGCACTGTTGTAGGTGCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	202456972	202595667	24	99.6	Internal No-hit

Length: 1091 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW91509	99.9	pleckstrin homo...	Homo sapiens
AAI52476	100.0	Pleckstrin homo...	Homo sapiens
EAW91510	99.9	pleckstrin homo...	Homo sapiens
Q9Y2H5	99.8	Pleckstrin homo...	Homo sapiens
XP_001488918	92.2	similar to Plec...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051473	2.2e-14	31.3	KIAA1686

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	103	201	PF00169	Pleckstrin-like
HMMSmart	IPR001849	103	203	SM00233	Pleckstrin-like
ProfileScan	IPR001849	102	201	PS50003	Pleckstrin-like

Primer_f	AGGCTAGGCGCTCTCATGATC
Primer_r	GGCTACATTCGTCTCCAGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-