KIAA0919

Gene/Protein Characteristic Table for KIAA0919

Order Kazusa clone(s) from :

Product ID	ORK00146
Accession No	AB023136
Description	exocyst complex component 6B
Clone name	hh02580
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5782 bp) Predicted protein sequence (710 aa)
Flexi ORF Clone	FXC00146
Source	Human adult brain
Rouge ID	mKIAA0919 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5782 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3648 bp
Genome contig ID	gi89161199r_72442113
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- ATTCATTAAAAATATATTCGTTATTTCTTAACTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGAGATGTGATCTTATTTTAATTAATATATACACAAATTAAATATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	72542113	72906662	18	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 710 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515544	99.9	hypothetical pr...	Pan troglodytes
Q9Y2D4	100.0	Exocyst complex...	Homo sapiens
CAH90169	100.0	hypothetical pr...	Pongo abelii
XP_540235	99.4	similar to Exoc...	Canis lupus fam...
XP_001492141	99.2	exocyst complex...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007225	502	710	PF04091	Exocyst complex subunit Sec15-like

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGTCTACGTTCCTCAAATGCC
Primer_r	CAGATAAATGCTCCCACTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 2

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGTCTACGTTCCTCAAATGCC
Primer_r	CAGATAAATGCTCCCACTAGG
PCR product length	188 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp