Order Kazusa clone(s) from : ![]() |
Product ID | ORK00651 |
---|---|
Accession No | AB020646 |
Description | RAB3 GTPase activating protein subunit 2 (non-catalytic) |
Clone name | hk04507s1 |
Vector information | |
cDNA sequence | DNA sequence (4961 bp) Predicted protein sequence (1393 aa) |
HaloTag ORF Clone |
FHC00651
![]() |
Flexi ORF Clone | FXC00651 |
Source | Human adult brain |
Rouge ID |
mKIAA0839
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04507, former representative clones for KIAA0839 with hk04507s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 779 bp |
---|---|
Genome contig ID | gi89161185r_218290437 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 218390437 | 218512302 | 35 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AGCGTATAGAACACCCCACTC |
---|---|
Primer_r | TCCTCAAGCACGGTCATCCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |