Order Kazusa clone(s) from : ![]() |
Product ID | ORK00134 |
---|---|
Accession No | AB020627 |
Description | dynamin 3, transcript variant 2 |
Clone name | bg00036 |
Vector information | |
cDNA sequence | DNA sequence (6407 bp) Predicted protein sequence (892 aa) |
HaloTag ORF Clone |
FHC00134
![]() |
Flexi ORF Clone | FXC00134 |
Source | Human adult brain |
Rouge ID |
mKIAA0820
by Kazusa Mouse cDNA Project
|
Note | We replaced hh02540, former representative clones for KIAA0820 with bg00036. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3697 bp |
---|---|
Genome contig ID | gi89161185f_169977290 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (670013 - 670062) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 170077290 | 170647301 | 19 | 99.3 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001401 | 64 | 82 | PR00195 | Dynamin |
IPR001401 | 89 | 106 | PR00195 | Dynamin | |
IPR001401 | 159 | 176 | PR00195 | Dynamin | |
IPR001401 | 209 | 227 | PR00195 | Dynamin | |
IPR001401 | 228 | 244 | PR00195 | Dynamin | |
IPR001401 | 251 | 270 | PR00195 | Dynamin | |
HMMPfam | IPR001401 | 67 | 240 | PF00350 | Dynamin |
IPR000375 | 249 | 542 | PF01031 | Dynamin central region | |
IPR001849 | 549 | 654 | PF00169 | Pleckstrin-like | |
IPR003130 | 677 | 768 | PF02212 | Dynamin GTPase effector | |
HMMSmart | IPR001401 | 39 | 278 | SM00053 | Dynamin |
IPR001849 | 549 | 656 | SM00233 | Pleckstrin-like | |
IPR003130 | 677 | 768 | SM00302 | Dynamin GTPase effector | |
ProfileScan | IPR001849 | 548 | 654 | PS50003 | Pleckstrin-like |
ScanRegExp | IPR001401 | 90 | 99 | PS00410 | Dynamin |
![]() |
Primer_f | CTCCAGATTGTAGTCATTTTG |
---|---|
Primer_r | GGTCTCCAGAGGTTTTACTTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGTCTCCAGAGGTTTTACTTC |
Primer_r | CTCCAGATTGTAGTCATTTTG |
PCR product length | 161 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |