Order Kazusa clone(s) from : ![]() |
Product ID | ORK00645 |
---|---|
Accession No | AB011541 |
Description | multiple EGF-like-domains 8, transcript variant 2 |
Clone name | hg01392s2 |
Vector information | |
cDNA sequence | DNA sequence (9984 bp) Predicted protein sequence (2785 aa) |
Flexi ORF Clone | FXC00645 |
Source | Human adult brain |
Rouge ID |
mKIAA0817
by Kazusa Mouse cDNA Project
|
Note | We replaced hg01392, former representative clones for KIAA0817 with hg01392s2. (1998/8/22) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1012 bp |
---|---|
Genome contig ID | gi42406306f_47421601 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (152179 - 152228) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 47521601 | 47573778 | 41 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000859 | 57 | 144 | PF00431 | CUB |
IPR013111 | 181 | 209 | PF07974 | EGF | |
IPR006652 | 285 | 332 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 454 | 505 | PF01344 | Kelch repeat type 1 | |
IPR002165 | 889 | 944 | PF01437 | Plexin | |
IPR002165 | 945 | 1013 | PF01437 | Plexin | |
IPR013091 | 1014 | 1054 | PF07645 | EGF calcium-binding | |
IPR002049 | 1103 | 1148 | PF00053 | EGF-like | |
IPR002049 | 1151 | 1199 | PF00053 | EGF-like | |
IPR006652 | 1505 | 1553 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 1611 | 1662 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 1724 | 1763 | PF01344 | Kelch repeat type 1 | |
IPR002049 | 2209 | 2242 | PF00053 | EGF-like | |
HMMSmart | IPR000859 | 40 | 147 | SM00042 | CUB |
IPR006210 | 148 | 177 | SM00181 | EGF | |
IPR006210 | 180 | 210 | SM00181 | EGF | |
IPR003659 | 568 | 620 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 787 | 839 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 840 | 887 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 889 | 931 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 945 | 1013 | SM00423 | Plexin/semaphorin/integrin | |
IPR001881 | 1014 | 1055 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1017 | 1055 | SM00181 | EGF | |
IPR006210 | 1057 | 1100 | SM00181 | EGF | |
IPR002049 | 1103 | 1148 | SM00180 | EGF-like | |
IPR006210 | 1110 | 1149 | SM00181 | EGF | |
IPR006210 | 1150 | 1200 | SM00181 | EGF | |
IPR002049 | 1151 | 1199 | SM00180 | EGF-like | |
IPR006210 | 1346 | 1385 | SM00181 | EGF | |
IPR006210 | 1388 | 1421 | SM00181 | EGF | |
IPR003659 | 1816 | 1856 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 1864 | 1919 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 2000 | 2058 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 2060 | 2117 | SM00423 | Plexin/semaphorin/integrin | |
IPR001881 | 2118 | 2160 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 2121 | 2160 | SM00181 | EGF | |
IPR006210 | 2162 | 2190 | SM00181 | EGF | |
IPR002049 | 2178 | 2239 | SM00180 | EGF-like | |
IPR006210 | 2200 | 2240 | SM00181 | EGF | |
IPR006210 | 2241 | 2304 | SM00181 | EGF | |
IPR002049 | 2244 | 2317 | SM00180 | EGF-like | |
IPR006210 | 2328 | 2382 | SM00181 | EGF | |
ProfileScan | IPR000859 | 37 | 147 | PS01180 | CUB |
IPR000742 | 177 | 210 | PS50026 | EGF-like | |
IPR000742 | 1014 | 1055 | PS50026 | EGF-like | |
IPR002049 | 1103 | 1150 | PS50027 | EGF-like | |
IPR002049 | 1151 | 1201 | PS50027 | EGF-like | |
IPR000859 | 1203 | 1345 | PS01180 | CUB | |
IPR000742 | 1343 | 1385 | PS50026 | EGF-like | |
IPR000742 | 2118 | 2156 | PS50026 | EGF-like | |
IPR002049 | 2193 | 2241 | PS50027 | EGF-like | |
IPR002049 | 2320 | 2383 | PS50027 | EGF-like | |
ScanRegExp | IPR013032 | 165 | 176 | PS00022 | EGF-like region |
IPR013032 | 165 | 176 | PS01186 | EGF-like region | |
IPR013032 | 198 | 209 | PS00022 | EGF-like region | |
IPR013032 | 198 | 209 | PS01186 | EGF-like region | |
IPR001304 | 788 | 812 | PS00615 | C-type lectin | |
IPR001881 | 1014 | 1040 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 1031 | 1042 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR013032 | 1040 | 1054 | PS01186 | EGF-like region | |
IPR002049 | 1119 | 1153 | PS01248 | EGF-like | |
IPR013032 | 1171 | 1182 | PS00022 | EGF-like region | |
IPR002049 | 1171 | 1203 | PS01248 | EGF-like | |
IPR013032 | 1373 | 1384 | PS00022 | EGF-like region | |
IPR013032 | 1373 | 1384 | PS01186 | EGF-like region | |
IPR013032 | 1409 | 1420 | PS00022 | EGF-like region | |
IPR013032 | 1409 | 1420 | PS01186 | EGF-like region | |
IPR000152 | 2135 | 2146 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR013032 | 2144 | 2159 | PS01186 | EGF-like region | |
IPR013032 | 2178 | 2189 | PS00022 | EGF-like region | |
IPR013032 | 2178 | 2193 | PS01186 | EGF-like region | |
IPR002049 | 2210 | 2242 | PS01248 | EGF-like | |
IPR002049 | 2291 | 2322 | PS01248 | EGF-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 8 | MALGKVLAMALVLALAVLGSLSP | 30 | PRIMARY | 23 |
2 | 2588 | LFVFFSVFFSCFFLFLSLCVLLW | 2610 | PRIMARY | 23 |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | nakayama |
---|---|
Primer_f | GATGGGGCCTCCTTTGTTCTG |
Primer_r | GTCTCTTGGTTCCTGCTTTGC |
PCR product length | 98 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |