KIAA0751

Product ID	ORK01118
Accession No	AB018294
Description	regulating synaptic membrane exocytosis 2, transcript variant 3
Clone name	hk04424
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3854 bp) Predicted protein sequence (1200 aa)
HaloTag ORF Clone	FHC01118
Flexi ORF Clone	FXC01118
Source	Human adult brain
Rouge ID	mKIAA0751 by Kazusa Mouse cDNA Project

Length: 3854 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	39 bp
Genome contig ID	gi51511724f_104800664
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTAAAAAAATTGTTGTCACAGCAACCAGCGTTAC
Flanking genome sequence (532601 - 532650)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAATCACAGGTTGCAAACCCTGGTAACACTGCATGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	104900664	105333263	21	99.9	Perfect prediction

Length: 1200 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW91890	100.0	regulating syna...	Homo sapiens
XP_519899	99.8	regulating syna...	Pan troglodytes
XP_859448	97.9	similar to Regu...	Canis lupus fam...
Q9UQ26	100.0	Regulating syna...	Homo sapiens
XP_859268	97.8	similar to Regu...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002338	2.3e-67	55.9	KIAA0340
D87074	2.7e-34	69.5	KIAA0237
AB011131	0.00021	24.7	KIAA0559
AB018290	0.00045	29.7	KIAA0747

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	626	638	PR00360	C2 calcium-dependent membrane targeting
FPrintScan	IPR000008	655	668	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR001478	457	542	PF00595	PDZ/DHR/GLGF
	IPR000008	611	702	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	1061	1148	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001478	466	545	SM00228	PDZ/DHR/GLGF
	IPR000008	610	717	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	1060	1163	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR001478	457	543	PS50106	PDZ/DHR/GLGF
	IPR000008	607	702	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	1060	1148	PS50004	C2 calcium-dependent membrane targeting

Primer_f	TCCCACCTTCCTCCCTAGTAG
Primer_r	TGAACGAGAGTAAGAAGGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-