KIAA0738

Product ID	ORK01604
Accession No	AB018281
Description	TRPM8 channel-associated factor 1, transcript variant 1
Clone name	hk03873
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4076 bp) Predicted protein sequence (941 aa)
HaloTag ORF Clone	FHC01604
Flexi ORF Clone	FXC01604
Source	Human adult brain
Rouge ID	mKIAA0738 by Kazusa Mouse cDNA Project

Length: 4076 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1177 bp
Genome contig ID	gi89161213r_143080982
PolyA signal sequence (GATAAA,-26)	+--------+--------+----*----+---- ATCTCTCCAGATAAAGAGCAAAAAGAAATAGATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATATAAAGAAAGAAAAAAGACATAGACAATCAATATGTAATGTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	143180982	143230105	9	99.5	Perfect prediction

Length: 941 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF84294	100.0	unnamed protein...	Homo sapiens
Q9Y4C2	99.9	Protein FAM115A.	Homo sapiens
AAH00609	100.0	FAM115A protein...	Homo sapiens
AAQ96853	99.9	unknown [Homo s...	Homo sapiens
Q5R8R3	99.2	Protein FAM115A.	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CAGAGAGATAAGAGTTGGTGC
Primer_r	AACAGGCACTTGAGTAGGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 7

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CAGAGAGATAAGAGTTGGTGC
Primer_r	AACAGGCACTTGAGTAGGAGG
PCR product length	123 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles