| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00601 | 
|---|---|
| Accession No | AB014569 | 
| Description | TSC22 domain family, member 2, transcript variant 1 | 
| Clone name | hk02346 | 
| Vector information | |
| cDNA sequence | DNA sequence (4550 bp) Predicted protein sequence (825 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00601
     
     
     | 
| Flexi ORF Clone | FXC00601 | 
| Source | Human adult brain | 
 Length: 4550 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | Warning | 
 
        Length: 825 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| BlastProDom | IPR000580 | 739 | 793 | PD007152 | TSC-22 / Dip / Bun | 
| HMMPfam | IPR000580 | 739 | 799 | PF01166 | TSC-22 / Dip / Bun | 
| ScanRegExp | IPR000580 | 739 | 755 | PS01289 | TSC-22 / Dip / Bun | 
           
	  RT-PCR
	   | 
	  
	  
|---|
 Experimental conditions| Primer_f | ATCCTGGTAGCACTTCTCAAC | 
|---|---|
| Primer_r | TGCTGAGGAGACATTCGGCTG | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 3
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | CCGGCTGAATTAGGCATCTCC | 
| Primer_r | CAATTCAATTCCCTCAGAGGC | 
| PCR product length | 294 bp | 
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |