KIAA0650

Gene/Protein Characteristic Table for KIAA0650

Order Kazusa clone(s) from :

Product ID	ORK06904
Accession No	AB014550
Description	structural maintenance of chromosomes flexible hinge domain containing 1
Clone name	hj04147
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone has an irregular adaptor sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5003 bp) Predicted protein sequence (848 aa)
Source	Human adult brain
Rouge ID	mKIAA0650 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5003 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2454 bp
Genome contig ID	gi51511735f_2629474
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- GTAACTGAAATAAAACTCTCTCCAAGCCTTTTTGC
Flanking genome sequence (165537 - 165586)	----+--------+--------+--------+--------+----* ACATTACGTTCATCAGTTTTCATGTGTACATTTGGCCAGGCCTATGGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	2729474	2795009	22	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 848 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX01691	100.0	hCG37227, isofo...	Homo sapiens
A6NHR9	100.0	Structural main...	Homo sapiens
XP_512045	99.3	hypothetical pr...	Pan troglodytes
XP_547657	90.7	similar to SMC ...	Canis lupus fam...
XP_618082	89.5	structural main...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010935	561	690	PF06470	SMCs flexible hinge

Expression profile

Description

RT-PCR

RT-PCR-ELISA

Experimental conditions

Primer_f	TTTAGATTAGGGATACTCACC
Primer_r	TATACGTTCAAGTCTAGTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 18

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TTTAGATTAGGGATACTCACC
Primer_r	TATACGTTCAAGTCTAGTTCC
PCR product length	131 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp