|
Order Kazusa clone(s) from : |
| Product ID | ORK00584 |
|---|---|
| Accession No | AB014538 |
| Description | pleckstrin homology-like domain, family B, member 1 |
| Clone name | hj03347s1 |
| Vector information | |
| ORF sequence | DNA sequence (5449 bp) Protein sequence (1384 aa) |
|
HaloTag ORF Clone |
FHC00584
|
| Flexi ORF Clone | FXC00584 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0638
by Kazusa Mouse cDNA Project
|
| Note | We replaced hj03347, former representative clones for KIAA0638 with hj03347s1. (2002/5/10) |
Length: 5449 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1208 bp |
|---|---|
| Genome contig ID | gi51511727f_117883551 |
| PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (150402 - 150451) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 11 | f | 117983547 | 118033951 | 23 | 99.7 | Terminal No-hit |
Length: 1384 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Chromosome No. 11
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TTAGAGCCAGAAGGGATGAAG |
| Primer_r | ACAGAACTCCAACCATAACCC |
| PCR product length | 97 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |