KIAA0479

Product ID	ORK00547
Accession No	AB007948
Description	nicotinamide nucleotide adenylyltransferase 2, transcript variant 1
Clone name	hh00797
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5431 bp) Predicted protein sequence (340 aa)
HaloTag ORF Clone	FHC00547
Flexi ORF Clone	FXC00547
Source	Human adult brain
Rouge ID	mKIAA0479 by Kazusa Mouse cDNA Project

Length: 5431 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4407 bp
Genome contig ID	gi89161185r_181384001
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATGTTTCAATTATGTTAATAAATAAGACAATGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAAGAGTCTTGTGTCTTGGTCAAGAACTTTCTCTGTGAATTGCAGCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	181484001	181654125	11	99.2	Perfect prediction

Length: 340 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001109387	1.4e-151	99.4	similar to nico...	Macaca mulatta
Q9BZQ4	6.2e-135	100.0	Nicotinamide mo...	Homo sapiens
Q5RBL5	1.6e-134	99.7	Nicotinamide mo...	Pongo abelii
XP_001489645	3.1e-134	99.3	similar to nico...	Equus caballus
BAF84079	1.5e-133	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004820	45	309	PF01467	Cytidylyltransferase
HMMTigr	IPR005248	45	335	TIGR00482	Probable nicotinate-nucleotide adenylyltransferase

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	ACCACCAAGACCCACGTTATC
Primer_r	ATCTGAATGTGCCCTTTGGTG
PCR product length	71 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles