Order Kazusa clone(s) from : ![]() |
Product ID | ORK00083 |
---|---|
Accession No | AB007940 |
Description | RAB GTPase activating protein 1-like, transcript variant 4 |
Clone name | hg03220 |
Vector information | |
cDNA sequence | DNA sequence (6834 bp) Predicted protein sequence (413 aa) |
HaloTag ORF Clone |
FHC00083
![]() |
Flexi ORF Clone | FXC00083 |
Source | Human adult brain |
Rouge ID |
mKIAA0471
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5309 bp |
---|---|
Genome contig ID | gi89161185f_172935741 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (295328 - 295377) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 173035658 | 173231067 | 10 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGGCTCACAAAAACAGTCACC |
Primer_r | ATGACCAATTAGACGTTTCCG |
PCR product length | 236 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |