KIAA0418

Product ID	ORK00072
Accession No	AB007878
Description	SH3 and PX domains 2A
Clone name	hh00988
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5504 bp) Predicted protein sequence (989 aa)
HaloTag ORF Clone	FHC00072
Flexi ORF Clone	FXC00072
Source	Human adult brain

Length: 5504 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2296 bp
Genome contig ID	gi89161187r_105249267
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATTTATGACTATTTAAAATAAAATTTAAAAGTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGACTGTCAGGTAAAGAACCTTCAATGTAGCTATCTTCCAGGGGGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	105349267	105443371	12	99.2	Perfect prediction

Length: 989 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI13961	98.9	SH3 and PX doma...	Homo sapiens
EAW49625	98.9	SH3 and PX doma...	Homo sapiens
BAH14354	99.9	unnamed protein...	Homo sapiens
BAH12146	99.8	unnamed protein...	Homo sapiens
XP_508015	98.7	SH3 multiple do...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037716	9.1e-08	27.2	KIAA1295

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	54	105	PD000066	Src homology-3
	IPR001452	133	176	PD000066	Src homology-3
	IPR001452	309	359	PD000066	Src homology-3
	IPR001452	701	750	PD000066	Src homology-3
	IPR001452	933	986	PD000066	Src homology-3
FPrintScan	IPR001452	67	82	PR00452	Src homology-3
FPrintScan	IPR001452	167	179	PR00452	Src homology-3
HMMPfam	IPR001452	53	107	PF00018	Src homology-3
	IPR001452	125	179	PF00018	Src homology-3
	IPR001452	323	361	PF00018	Src homology-3
	IPR001452	706	753	PF00018	Src homology-3
	IPR001452	954	988	PF00018	Src homology-3
HMMSmart	IPR001452	53	108	SM00326	Src homology-3
	IPR001452	125	180	SM00326	Src homology-3
	IPR001452	307	362	SM00326	Src homology-3
	IPR001452	699	754	SM00326	Src homology-3
	IPR001452	931	989	SM00326	Src homology-3
ProfileScan	IPR001452	50	109	PS50002	Src homology-3
	IPR001452	122	181	PS50002	Src homology-3
	IPR001452	304	363	PS50002	Src homology-3
	IPR001452	707	755	PS50002	Src homology-3
	IPR001452	942	989	PS50002	Src homology-3

Primer_f	TCAGCTCAGATGTCACCTTCC
Primer_r	CAGCAGGGGACGATGTGACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CACTTTGCTCTCTGGGTTTTT
Primer_r	TGGTAGTGGTTTAGTGTCTTC
PCR product length	126 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles