Gene/Protein Characteristic Table for KIAA0342
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05593
Accession No AB002340
Description tetratricopeptide repeat and ankyrin repeat containing 1
Clone name bf03307
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (8859 bp)
Predicted protein sequence (2467 aa)
Source Human adult brain
Rouge ID mKIAA0342 by Kazusa Mouse cDNA Project
Note We replaced hg03234, former representative clones for KIAA0342 with bf03307. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 8859 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1455 bp
Genome contig ID gi89161205r_36743315
PolyA signal sequence
(TATAAA,-23)		 
+----*----+----*----+----*----+----
TATCACATTTTTTATAAAGTTAAAGCATTTCTCTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACATGCTGCCGTTTTATTTCCAGTCTCTACTCAGAGTAAGGGGGTAAATC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 3 r 36843315 36875378 13 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 2467 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW64479 0 100.0 hCG2042887, iso...
 Homo sapiens
O15050 0 100.0 Lupus brain ant...
 Homo sapiens
NP_055646 0 100.0 lupus brain ant...
 Homo sapiens
XP_236660 0 83.4 hypothetical pr...
 Rattus norvegicus
Q8BV79 0 83.3 Lupus brain ant...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan IPR002110 5 131 PS50297 Ankyrin
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AGCAGCATGAGCAGCAAAAGC
Primer_r CCTCTCTGATGGTTACTGCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f AGCAGCATGAGCAGCAAAAGC
Primer_r CCTCTCTGATGGTTACTGCCC
PCR product length 150 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp