KIAA0328

Product ID	ORK04086
Accession No	AB002326
Description	Alstrom syndrome protein 1
Clone name	hg00685s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6720 bp) Predicted protein sequence (2055 aa)
Source	Human adult brain
Rouge ID	mKIAA0328 by Kazusa Mouse cDNA Project
Note	We replaced hg00685, former representative clones for KIAA0328 with hg00685s2. (2002/5/10)

Length: 6720 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	551 bp
Genome contig ID	gi89161199f_73433360
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGTCTGGGCGACAGAACGAGACTCCATCTC
Flanking genome sequence (251136 - 251185)	----+--------+--------+--------+--------+----* AAAAAAATTAAAAAAAAAGATTATTTTGAAATAAAATTAAATATGTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	73533360	73684494	14	99.8	Perfect prediction

Length: 2055 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW99730	100.0	Alstrom syndrom...	Homo sapiens
Q8TCU4	100.0	Alstrom syndrom...	Homo sapiens
NP_055935	100.0	ALMS1 [Homo sap...	Homo sapiens
CAD10391	100.0	ALMS1 protein [...	Homo sapiens
XP_001105030	94.9	similar to ALMS...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TGCAGGTTTTAGAGATGTTGG
Primer_r	TCTGCCTCCATCAAAAGTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 2

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGCAGGTTTTAGAGATGTTGG
Primer_r	TCTGCCTCCATCAAAAGTGTC
PCR product length	96 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles