Order Kazusa clone(s) from : ![]() |
Product ID | ORK05588 |
---|---|
Accession No | AB006622 |
Description | centrosomal protein 170B |
Clone name | pf09542 |
Vector information | |
cDNA sequence | DNA sequence (6677 bp) Predicted protein sequence (1573 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA0284
by Kazusa Mouse cDNA Project
|
Note | We replaced ha06488, former representative clones for KIAA0284 with pf09542. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1784 bp |
---|---|
Genome contig ID | gi51511730f_104302695 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (131430 - 131479) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 104402695 | 104434123 | 19 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | |
---|---|
Primer_r | |
PCR conditions | test |
Panel name | Genebridge 4 |
---|---|
Primer_f | CTGTCTGTATGGAGGAGGTGC |
Primer_r | AGCCGTGGATGAAGCGTGACC |
PCR product length | 117 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |