KIAA0284

Product ID	ORK05588
Accession No	AB006622
Description	centrosomal protein 170B
Clone name	pf09542
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6677 bp) Predicted protein sequence (1573 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA0284 by Kazusa Mouse cDNA Project
Note	We replaced ha06488, former representative clones for KIAA0284 with pf09542. (2005/08/06)

Length: 6677 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1784 bp
Genome contig ID	gi51511730f_104302695
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGGAATTTGTTCTAATAAATCATTCTTCTATCAC
Flanking genome sequence (131430 - 131479)	----+--------+--------+--------+--------+----* ATGGCAGCACGCTGGAGCCTGTCACCTTGGCCTTGTTTCTCTATCCTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	104402695	104434123	19	99.3	Perfect prediction

Length: 1573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001106197	99.9	hypothetical pr...	Homo sapiens
NP_055820	99.9	hypothetical pr...	Homo sapiens
XP_001085960	92.7	similar to KARP...	Macaca mulatta
XP_001085858	92.9	similar to KARP...	Macaca mulatta
XP_548002	77.9	similar to KARP...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007939	1.6e-11	32.3	KIAA0470

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	42	109	PF00498	Forkhead-associated
HMMSmart	IPR000253	41	92	SM00240	Forkhead-associated
ProfileScan	IPR000253	42	92	PS50006	Forkhead-associated

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTGTCTGTATGGAGGAGGTGC
Primer_r	AGCCGTGGATGAAGCGTGACC
PCR product length	117 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles