Gene/Protein Characteristic Table for KIAA0236
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01966
Accession No D87073
Description zinc finger protein 142, transcript variant 1
Clone name ha04654
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (5878 bp)
Predicted protein sequence (1696 aa)
Flexi ORF Clone FXC01966
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0236 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5878 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 378 bp
Genome contig ID gi89161199r_219110928
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TTCAGAATCTTCTAAAAACAGTTGTATCTAACCGC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATGTGCTGTTGTGCCTAATGCTCTATAAAGCATGTTAAACAGAAAGTGGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 r 219210928 219232505 10 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 1696 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG72874 0 100.0 zinc finger pro...
 synthetic construct
P52746 0 99.9 Zinc finger pro...
 Homo sapiens
NP_001099007 0 99.9 zinc finger pro...
 Homo sapiens
EAW70631 0 99.9 zinc finger pro...
 Homo sapiens
NP_005072 0 99.9 zinc finger pro...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D31763 4.5e-16 29.5 KIAA0065
AB058774 8.6e-15 27.7 KIAA1871
AB095928 9.7e-13 29.3 KIAA2007
AB023189 2.6e-12 25.6 KIAA0972
AB075862 2.9e-12 28.9 KIAA1982
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 172 194 PF00096 Zinc finger
IPR007087 262 284 PF00096 Zinc finger
IPR007087 410 432 PF00096 Zinc finger
IPR007087 438 460 PF00096 Zinc finger
IPR007087 466 488 PF00096 Zinc finger
IPR007087 521 544 PF00096 Zinc finger
IPR007087 845 868 PF00096 Zinc finger
IPR007087 875 898 PF00096 Zinc finger
IPR007087 1209 1231 PF00096 Zinc finger
IPR007087 1237 1260 PF00096 Zinc finger
IPR007087 1295 1318 PF00096 Zinc finger
IPR007087 1489 1511 PF00096 Zinc finger
IPR007087 1517 1539 PF00096 Zinc finger
IPR007087 1545 1568 PF00096 Zinc finger
IPR007087 1574 1596 PF00096 Zinc finger
IPR007087 1602 1624 PF00096 Zinc finger
HMMSmart IPR015880 172 194 SM00355 Zinc finger
IPR015880 200 220 SM00355 Zinc finger
IPR015880 228 251 SM00355 Zinc finger
IPR015880 262 284 SM00355 Zinc finger
IPR015880 295 320 SM00355 Zinc finger
IPR015880 325 349 SM00355 Zinc finger
IPR015880 352 375 SM00355 Zinc finger
IPR015880 381 404 SM00355 Zinc finger
IPR015880 410 432 SM00355 Zinc finger
IPR015880 438 460 SM00355 Zinc finger
IPR015880 466 488 SM00355 Zinc finger
IPR015880 494 516 SM00355 Zinc finger
IPR015880 521 544 SM00355 Zinc finger
IPR015880 553 576 SM00355 Zinc finger
IPR015880 582 605 SM00355 Zinc finger
IPR015880 845 867 SM00355 Zinc finger
IPR015880 875 895 SM00355 Zinc finger
IPR015880 1035 1055 SM00355 Zinc finger
IPR015880 1113 1133 SM00355 Zinc finger
IPR015880 1144 1167 SM00355 Zinc finger
IPR015880 1180 1203 SM00355 Zinc finger
IPR015880 1209 1231 SM00355 Zinc finger
IPR015880 1237 1260 SM00355 Zinc finger
IPR015880 1266 1289 SM00355 Zinc finger
IPR015880 1295 1318 SM00355 Zinc finger
IPR015880 1337 1360 SM00355 Zinc finger
IPR015880 1363 1386 SM00355 Zinc finger
IPR015880 1389 1412 SM00355 Zinc finger
IPR015880 1433 1455 SM00355 Zinc finger
IPR015880 1461 1483 SM00355 Zinc finger
IPR015880 1489 1511 SM00355 Zinc finger
IPR015880 1517 1539 SM00355 Zinc finger
IPR015880 1545 1568 SM00355 Zinc finger
IPR015880 1574 1596 SM00355 Zinc finger
IPR015880 1602 1624 SM00355 Zinc finger
IPR015880 1630 1652 SM00355 Zinc finger
ProfileScan IPR007087 172 199 PS50157 Zinc finger
IPR007087 200 227 PS50157 Zinc finger
IPR007087 262 289 PS50157 Zinc finger
IPR007087 352 380 PS50157 Zinc finger
IPR007087 410 437 PS50157 Zinc finger
IPR007087 438 465 PS50157 Zinc finger
IPR007087 466 493 PS50157 Zinc finger
IPR007087 494 521 PS50157 Zinc finger
IPR007087 1180 1208 PS50157 Zinc finger
IPR007087 1237 1265 PS50157 Zinc finger
IPR007087 1295 1323 PS50157 Zinc finger
IPR007087 1363 1391 PS50157 Zinc finger
IPR007087 1461 1488 PS50157 Zinc finger
IPR007087 1489 1516 PS50157 Zinc finger
IPR007087 1517 1544 PS50157 Zinc finger
IPR007087 1545 1573 PS50157 Zinc finger
IPR007087 1574 1601 PS50157 Zinc finger
IPR007087 1602 1629 PS50157 Zinc finger
ScanRegExp IPR007087 174 194 PS00028 Zinc finger
IPR007087 264 284 PS00028 Zinc finger
IPR007087 327 349 PS00028 Zinc finger
IPR007087 354 375 PS00028 Zinc finger
IPR007087 440 460 PS00028 Zinc finger
IPR007087 496 516 PS00028 Zinc finger
IPR007087 523 545 PS00028 Zinc finger
IPR007087 1182 1203 PS00028 Zinc finger
IPR007087 1239 1260 PS00028 Zinc finger
IPR007087 1297 1318 PS00028 Zinc finger
IPR007087 1339 1360 PS00028 Zinc finger
IPR007087 1365 1386 PS00028 Zinc finger
IPR007087 1435 1455 PS00028 Zinc finger
IPR007087 1491 1511 PS00028 Zinc finger
IPR007087 1519 1539 PS00028 Zinc finger
IPR007087 1576 1596 PS00028 Zinc finger
IPR007087 1604 1624 PS00028 Zinc finger
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name Genebridge 4
Primer_f GTTCTCAGTTTCTTCACCATC
Primer_r GGAATTGACACAGTAAGAAGG
PCR product length 99 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp