Order Kazusa clone(s) from : ![]() |
Product ID | ORK00036 |
---|---|
Accession No | D86979 |
Description | RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein, transcript variant 1 |
Clone name | fg02838 |
Vector information | |
cDNA sequence | DNA sequence (5396 bp) Predicted protein sequence (973 aa) |
HaloTag ORF Clone |
FHC00036
![]() |
Flexi ORF Clone | FXC00036 |
Source | Human fetal brain |
Rouge ID |
mKIAA0226
by Kazusa Mouse cDNA Project
|
Note | We replaced ha04633, former representative clones for KIAA0226 with fg02838. (2001/10/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2377 bp |
---|---|
Genome contig ID | gi89161205r_198783253 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 198883253 | 198960656 | 22 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CGTTCTCTGCCAAGGATTTAG |
Primer_r | AGATGACAATGAACTGCCAGG |
PCR product length | 149 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |