Order Kazusa clone(s) from : ![]() |
Product ID | ORK00467 |
---|---|
Accession No | D86975 |
Description | zinc finger protein 516 |
Clone name | ha02586 |
Vector information | |
cDNA sequence | DNA sequence (6033 bp) Predicted protein sequence (1204 aa) |
HaloTag ORF Clone |
FHC00467
![]() |
Flexi ORF Clone | FXC00467 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0222
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2223 bp |
---|---|
Genome contig ID | gi51511735r_72101218 |
PolyA signal sequence (ATTAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 18 | r | 72201218 | 72336134 | 7 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 1139 | 1159 | PD000003 | Zinc finger |
HMMPfam | IPR007087 | 75 | 97 | PF00096 | Zinc finger |
IPR007087 | 103 | 125 | PF00096 | Zinc finger | |
IPR007087 | 289 | 311 | PF00096 | Zinc finger | |
IPR007087 | 317 | 339 | PF00096 | Zinc finger | |
IPR007087 | 1139 | 1161 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 75 | 97 | SM00355 | Zinc finger |
IPR015880 | 103 | 125 | SM00355 | Zinc finger | |
IPR015880 | 215 | 238 | SM00355 | Zinc finger | |
IPR015880 | 241 | 264 | SM00355 | Zinc finger | |
IPR015880 | 289 | 311 | SM00355 | Zinc finger | |
IPR015880 | 317 | 339 | SM00355 | Zinc finger | |
IPR015880 | 376 | 398 | SM00355 | Zinc finger | |
IPR015880 | 556 | 578 | SM00355 | Zinc finger | |
IPR015880 | 801 | 824 | SM00355 | Zinc finger | |
IPR015880 | 1139 | 1161 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 75 | 102 | PS50157 | Zinc finger |
IPR007087 | 103 | 125 | PS50157 | Zinc finger | |
IPR007087 | 289 | 316 | PS50157 | Zinc finger | |
IPR007087 | 317 | 344 | PS50157 | Zinc finger | |
IPR007087 | 376 | 403 | PS50157 | Zinc finger | |
IPR007087 | 556 | 583 | PS50157 | Zinc finger | |
IPR007087 | 1139 | 1162 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 77 | 97 | PS00028 | Zinc finger |
IPR007087 | 217 | 238 | PS00028 | Zinc finger | |
IPR007087 | 291 | 311 | PS00028 | Zinc finger | |
IPR007087 | 319 | 339 | PS00028 | Zinc finger | |
IPR007087 | 378 | 398 | PS00028 | Zinc finger | |
IPR007087 | 558 | 578 | PS00028 | Zinc finger | |
IPR007087 | 1141 | 1161 | PS00028 | Zinc finger |
Panel name | Genebridge 4 |
---|---|
Primer_f | CCACCTAAGAAATCAGAAGAC |
Primer_r | TTCCTAACAGTCACCATTCAC |
PCR product length | 130 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |