KIAA0205

Product ID	ORK00457
Accession No	D86960
Description	lysophosphatidylglycerol acyltransferase 1
Clone name	ha02324
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6253 bp) Predicted protein sequence (391 aa)
HaloTag ORF Clone	FHC00457
Flexi ORF Clone	FXC00457
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0205 by Kazusa Mouse cDNA Project

Length: 6253 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4913 bp
Genome contig ID	gi89161185r_209884960
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTTAAACCTAGAAAAAATAAAGTTGATTTTTTTC
Flanking genome sequence (99992 - 99943)	----+--------+--------+--------+--------+----* AATTAAAGTGCTTTTAATTCTTAGCAGTGGGGATGGGGCATGTGTGTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	209984952	210070737	8	99.2	Perfect prediction

Length: 391 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001170135	5.1e-173	97.5	lysophosphatidy...	Pan troglodytes
Q92604	1.7e-168	100.0	Acyl-CoA:lysoph...	Homo sapiens
XP_001170114	4.6e-168	99.7	lysophosphatidy...	Pan troglodytes
XP_001108531	8.7e-168	99.2	lysophosphatidy...	Macaca mulatta
BAE21857	2.6e-163	88.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR002123	116	232	SM00563	Phospholipid/glycerol acyltransferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	39	ALMRFAFMVVNNLVAIPSYICYV	61	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GTAAAGGGCTGGTCACACGTG
Primer_r	GCTTCTTTTGGTGTTCACATC
PCR product length	104 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles