Order Kazusa clone(s) from : ![]() |
Product ID | ORK00450 |
---|---|
Accession No | D83777 |
Description | secernin 1, transcript variant 2 |
Clone name | bh00167 |
Vector information | |
cDNA sequence | DNA sequence (5203 bp) Predicted protein sequence (443 aa) |
Flexi ORF Clone | FXC00450 |
Source | Human adult brain |
Rouge ID |
mKIAA0193
by Kazusa Mouse cDNA Project
|
Note | We replaced ha02308, former representative clones for KIAA0193 with bh00167. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3844 bp |
---|---|
Genome contig ID | gi89161213r_29826268 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99984 - 99935) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 29926252 | 29995895 | 8 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | TGTCATTTATTGGGGAAGGTC |
Primer_r | GACTGTGCAGAATGAAAAGCC |
PCR product length | 188 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |