Order Kazusa clone(s) from : ![]() |
Product ID | ORK04947 |
---|---|
Accession No | D80005 |
Description | family with sequence similarity 120A |
Clone name | ha02726 |
Vector information | |
cDNA sequence | DNA sequence (4904 bp) Predicted protein sequence (1111 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0183
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1566 bp |
---|---|
Genome contig ID | gi89161216f_95154038 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (214174 - 214223) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 95254038 | 95368210 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CACGTCAAGGTTGCACAGAGC |
Primer_r | GTGCATAATCAGAGTCATACG |
PCR product length | 106 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |