KIAA0146

Product ID	ORK00427
Accession No	D63480
Description	scaffolding protein involved in DNA repair, transcript variant 1
Clone name	ha03238
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3218 bp) Predicted protein sequence (918 aa)
HaloTag ORF Clone	FHC00427
Flexi ORF Clone	FXC00427
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0146 by Kazusa Mouse cDNA Project

Length: 3218 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	461 bp
Genome contig ID	gi51511724f_48236095
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GATATTACTGTTCTGCTACAATAAATGTCAAACCT
Flanking genome sequence (574933 - 574982)	----+--------+--------+--------+--------+----* AAGCACTTTGCAGTTCACTACTTTTGGGAAAATGTTCTAGGGAACTGTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	48336095	48811026	20	100.0	Perfect prediction

Length: 918 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001104319	94.6	hypothetical pr...	Macaca mulatta
BAG57563	99.8	unnamed protein...	Homo sapiens
BAG64598	99.6	unnamed protein...	Homo sapiens
BAG57216	100.0	unnamed protein...	Homo sapiens
EAW86675	99.4	hCG1810961, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 8

Experimental conditions

Panel name	Genebridge 4
Primer_f	CTCTTCATTTGGTATTTAGGC
Primer_r	TATCACAGTATGGGACAAAGG
PCR product length	168 bp
PCR conditions	95 °C15 sec60 °C120 sec30 cycles