Order Kazusa clone(s) from : ![]() |
Product ID | ORK01052 |
---|---|
Accession No | D31886 |
Description | RAB3 GTPase activating protein subunit 1 (catalytic), transcript variant 2 |
Clone name | ha01217 |
Vector information | |
cDNA sequence | DNA sequence (3635 bp) Predicted protein sequence (981 aa) |
HaloTag ORF Clone |
FHC01052
![]() |
Flexi ORF Clone | FXC01052 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0066
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 687 bp |
---|---|
Genome contig ID | gi89161199f_135426468 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (217042 - 217091) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 135526346 | 135643508 | 24 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | TGAGGGGAAAAAGACAAGTGC |
Primer_r | CCTACCTCTCCCTTTTCCTTA |
PCR product length | 123 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |