Order Kazusa clone(s) from : ![]() |
Product ID | ORK03385 |
---|---|
Accession No | AK024444 |
Clone name | as00034 |
Vector information | |
cDNA sequence | DNA sequence (4305 bp) Predicted protein sequence (1343 aa) |
HaloTag ORF Clone |
FHC03385
![]() |
Flexi ORF Clone | FXC03385 |
Source | Human spleen |
Rouge ID |
mFLJ00034
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR003993 | 919 | 937 | PR01503 | Treacher Collins syndrome protein Treacle |
IPR003993 | 1053 | 1066 | PR01503 | Treacher Collins syndrome protein Treacle | |
ProfileScan | IPR000694 | 215 | 298 | PS50099 | Proline-rich region |
NULL | 222 | 238 | PS50324 | NULL | |
NULL | 299 | 319 | PS50313 | NULL | |
IPR000694 | 411 | 472 | PS50099 | Proline-rich region | |
NULL | 565 | 859 | PS50324 | NULL | |
NULL | 587 | 685 | PS50323 | NULL | |
IPR001472 | 624 | 641 | PS50079 | Bipartite nuclear localization signal | |
NULL | 927 | 957 | PS50318 | NULL | |
NULL | 1040 | 1070 | PS50313 | NULL | |
IPR000694 | 1315 | 1342 | PS50099 | Proline-rich region |
![]() |
Primer_f | TATCTGAAGAAGCTGCACACG |
---|---|
Primer_r | TTGATTTCCCCACTTTTGCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |