Gene/Protein Characteristic Table for FLJ00137 |
Description |
Product ID: | ORK01586 |
---|---|
Accession No.: | AK074066 |
Alias Name: | |
Clone Name: | sh02727 [Vector Info] |
Source: | Human spleen |
Features of the cloned DNA sequence | Description |
---|
Length: 5376
cloned DNA seq.
| |
Length of 3'UTR 794 bp Genome contig ID gi29824576r_154150134 PolyA signal sequence
(ATTAAA,-26) +----*----+----*----+----*----+----
GAGAATCAGATTAAACCCAAAAATACTCTTTGGAGFlanking genome sequence None
Features of the predicted protein sequence | Description |
---|
Length: 1512
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues