Gene/Protein Characteristic Table for FLJ00137

Description

Product ID:	ORK01586
Accession No.:	AK074066
Alias Name:
Clone Name:	sh02727 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 5376
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 794 bp

Genome contig ID gi29824576r_154150134
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
GAGAATCAGATTAAACCCAAAAATACTCTTTGGAG
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 1512

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB84892	100.0	FLJ00137 protei...	Homo sapiens
Q8TEQ6	99.9	Gem-associated ...	Homo sapiens
T17345	99.9	hypothetical pr...	Homo sapiens man
Q8BX17	82.0	Gem-associated ...	Mus musculus
XP_220448	73.5	similar to gem ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 638 672 PD000018 G-protein beta WD-40 repeat

FPrintScan IPR001680 86 100 PR00320 G-protein beta WD-40 repeat

IPR001680 246 260 PR00320 G-protein beta WD-40 repeat

IPR001680 659 673 PR00320 G-protein beta WD-40 repeat

HMMPfam IPR001680 59 99 PF00400 G-protein beta WD-40 repeat

IPR001680 104 142 PF00400 G-protein beta WD-40 repeat

IPR001680 147 184 PF00400 G-protein beta WD-40 repeat

IPR001680 190 259 PF00400 G-protein beta WD-40 repeat

IPR001680 329 369 PF00400 G-protein beta WD-40 repeat

IPR001680 374 412 PF00400 G-protein beta WD-40 repeat

IPR001680 421 459 PF00400 G-protein beta WD-40 repeat

IPR001680 465 515 PF00400 G-protein beta WD-40 repeat

IPR001680 573 617 PF00400 G-protein beta WD-40 repeat

IPR001680 634 672 PF00400 G-protein beta WD-40 repeat

IPR001680 677 715 PF00400 G-protein beta WD-40 repeat

HMMSmart IPR001680 57 99 SM00320 G-protein beta WD-40 repeat

IPR001680 102 142 SM00320 G-protein beta WD-40 repeat

IPR001680 144 184 SM00320 G-protein beta WD-40 repeat

IPR001680 188 259 SM00320 G-protein beta WD-40 repeat

IPR001680 320 369 SM00320 G-protein beta WD-40 repeat

IPR001680 372 412 SM00320 G-protein beta WD-40 repeat

IPR001680 419 459 SM00320 G-protein beta WD-40 repeat

IPR001680 464 515 SM00320 G-protein beta WD-40 repeat

IPR001680 533 568 SM00320 G-protein beta WD-40 repeat

IPR001680 571 617 SM00320 G-protein beta WD-40 repeat

IPR001680 632 672 SM00320 G-protein beta WD-40 repeat

IPR001680 675 715 SM00320 G-protein beta WD-40 repeat

ProfileScan IPR001680 64 108 PS50082 G-protein beta WD-40 repeat

IPR001680 64 724 PS50294 G-protein beta WD-40 repeat

IPR001680 245 268 PS50082 G-protein beta WD-40 repeat

IPR001680 639 672 PS50082 G-protein beta WD-40 repeat

ScanRegExp IPR001680 86 100 PS00678 G-protein beta WD-40 repeat

IPR001680 399 413 PS00678 G-protein beta WD-40 repeat

IPR001680 659 673 PS00678 G-protein beta WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	638	672	PD000018	G-protein beta WD-40 repeat
FPrintScan	IPR001680	86	100	PR00320	G-protein beta WD-40 repeat
IPR001680	246	260	PR00320	G-protein beta WD-40 repeat
IPR001680	659	673	PR00320	G-protein beta WD-40 repeat
HMMPfam	IPR001680	59	99	PF00400	G-protein beta WD-40 repeat
IPR001680	104	142	PF00400	G-protein beta WD-40 repeat
IPR001680	147	184	PF00400	G-protein beta WD-40 repeat
IPR001680	190	259	PF00400	G-protein beta WD-40 repeat
IPR001680	329	369	PF00400	G-protein beta WD-40 repeat
IPR001680	374	412	PF00400	G-protein beta WD-40 repeat
IPR001680	421	459	PF00400	G-protein beta WD-40 repeat
IPR001680	465	515	PF00400	G-protein beta WD-40 repeat
IPR001680	573	617	PF00400	G-protein beta WD-40 repeat
IPR001680	634	672	PF00400	G-protein beta WD-40 repeat
IPR001680	677	715	PF00400	G-protein beta WD-40 repeat
HMMSmart	IPR001680	57	99	SM00320	G-protein beta WD-40 repeat
IPR001680	102	142	SM00320	G-protein beta WD-40 repeat
IPR001680	144	184	SM00320	G-protein beta WD-40 repeat
IPR001680	188	259	SM00320	G-protein beta WD-40 repeat
IPR001680	320	369	SM00320	G-protein beta WD-40 repeat
IPR001680	372	412	SM00320	G-protein beta WD-40 repeat
IPR001680	419	459	SM00320	G-protein beta WD-40 repeat
IPR001680	464	515	SM00320	G-protein beta WD-40 repeat
IPR001680	533	568	SM00320	G-protein beta WD-40 repeat
IPR001680	571	617	SM00320	G-protein beta WD-40 repeat
IPR001680	632	672	SM00320	G-protein beta WD-40 repeat
IPR001680	675	715	SM00320	G-protein beta WD-40 repeat
ProfileScan	IPR001680	64	108	PS50082	G-protein beta WD-40 repeat
IPR001680	64	724	PS50294	G-protein beta WD-40 repeat
IPR001680	245	268	PS50082	G-protein beta WD-40 repeat
IPR001680	639	672	PS50082	G-protein beta WD-40 repeat
ScanRegExp	IPR001680	86	100	PS00678	G-protein beta WD-40 repeat
IPR001680	399	413	PS00678	G-protein beta WD-40 repeat
IPR001680	659	673	PS00678	G-protein beta WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	794 bp
Genome contig ID	gi29824576r_154150134
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GAGAATCAGATTAAACCCAAAAATACTCTTTGGAG
Flanking genome sequence	None