Gene/Protein Characteristic Table for FLJ00106 |
Description |
Product ID: | ORK01034 |
---|---|
Accession No.: | AK024498 |
Alias Name: | |
Clone Name: | as00106 [Vector Info] |
Source: | Human spleen |
Features of the cloned DNA sequence | Description |
---|
Length: 4551
cloned DNA seq.
| |
Features of the predicted protein sequence | Description |
---|
Length: 379
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA | Description |
---|
: TGTCTCAGGAACTCATGGCAG | |
: TGACCCAACACCCAAAGTAGG | |
: 95 °C |