Gene/Protein Characteristic Table for FLJ00065

Description

Product ID:	ORK04275
Accession No.:	AK024472
Alias Name:
Clone Name:	as00065 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4545
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3894 bp

Genome contig ID gi29824586r_37859232
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CAATTGGTACAATTTTTAATAAAATCATTTAAAGC
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 204

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15762	4.3e-85	100.0	FLJ00065 protei...	Homo sapiens
AAH60783	1.4e-76	100.0	BMF protein [Ho...	Homo sapiens
Q96LC9	8.4e-76	100.0	Bcl-2-modifying...	Homo sapiens
AAH69328	2e-75	99.5	BMF protein [Ho...	Homo sapiens
AAH69505	2.7e-75	99.5	Bcl2 modifying ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

Expression profile

RT-PCR-ELISA	Description

Experimental conditions

Primer_f	: TTGAGTCTTGAGGGGATAGCG
Primer_r	: CCCTGGGGATGAACAAAATGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3894 bp
Genome contig ID	gi29824586r_37859232
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CAATTGGTACAATTTTTAATAAAATCATTTAAAGC
Flanking genome sequence	None