Gene/Protein Characteristic Table for FLJ00052

Description

Product ID:	ORK03386
Accession No.:	AK024460
Alias Name:
Clone Name:	as00052 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4394
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the predicted protein sequence	Description

Length: 368

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15750	3.7e-109	100.0	FLJ00052 protei...	Homo sapiens
XP_509415	4e-109	100.0	similar to FLJ0...	Pan troglodytes
XP_001084823	1e-107	99.2	similar to Sin3...	Macaca mulatta
XP_001924353	2.9e-100	94.8	similar to Sin3...	Sus scrofa
XP_001914936	5.4e-99	94.5	similar to Sin3...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

Expression profile

RT-PCR-ELISA	Description

Experimental conditions

Primer_f	: CAGGGTGTTTTCATTCATGCG
Primer_r	: TGAACACAGGGTCTTATACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO