Gene/Protein Characteristic Table for FLJ00044

Description

Product ID:	ORK01032
Accession No.:	AK024452
Alias Name:
Clone Name:	as00044 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4340
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the predicted protein sequence	Description

Length: 1051

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB15742	100.0	FLJ00044 protei...	Homo sapiens
XP_524448	99.3	zinc finger, SW...	Pan troglodytes
Q9H7M6	100.0	Zinc finger SWI...	Homo sapiens
EAW84373	99.9	zinc finger, SW...	Homo sapiens
XP_867133	96.6	similar to Zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040944	3.2e-98	56.9	KIAA1511
AB046797	8.8e-92	63.5	KIAA1577
AB020720	1.7e-15	36.4	KIAA0913

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000637 67 78 PR00929 HMG-I and HMG-Y DNA-binding domain (A+T-hook)

IPR000637 86 96 PR00929 HMG-I and HMG-Y DNA-binding domain (A+T-hook)

HMMPfam IPR007527 201 238 PF04434 SWIM Zn-finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	67	78	PR00929	HMG-I and HMG-Y DNA-binding domain (A+T-hook)
IPR000637	86	96	PR00929	HMG-I and HMG-Y DNA-binding domain (A+T-hook)
HMMPfam	IPR007527	201	238	PF04434	SWIM Zn-finger

Method	From	To	amino acid sequence
-	-	-	-

Expression profile

RT-PCR-ELISA	Description

Experimental conditions

Primer_f	: CATCCAGCAGAACATCCACTC
Primer_r	: ATATTCATCAGGGCTTGCGGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO