ROUGE

Gene/Protein Characteristic Table for mKIAA4141

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220505
Description :	Slit homolog 2 protein precursor.
Clone Name :	mbg03129 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5762 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 715 bp

Genome contig ID gi65498774f_46647817
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TAGATTATTGATAAATAAAAATTAGTAATAATATG
Flanking genome sequence
(420964 - 421013)
----+----*----+----*----+----*----+----*----+----*
AATTTTTGTTTCTATGAGTTCTAAATATCCCTATACAGTATTCATTTTCA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 266..5044
Length: 1593 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL37631	99.7	slit homolog 2 ...	Mus musculus
AAI45489	99.7	Slit2 protein [...	Mus musculus
NP_848919	99.7	slit homolog 2 ...	Mus musculus
Q9R1B9	99.6	Slit homolog 2 ...	Mus musculus
EDL37632	99.7	slit homolog 2 ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122376	0	64.6	mKIAA0813
AK122223	9.6e-15	34.1	mKIAA0230
AK129367	3.5e-13	27.6	mKIAA1465
AK173296	8.3e-13	23.6	mKIAA1910
AK129223	1.4e-12	58.2	mKIAA0814

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 398 411 PR00019 Leucine-rich repeat

IPR001611 621 634 PR00019 Leucine-rich repeat

IPR001438 982 993 PR00010 Type II EGF-like signature

IPR001438 1152 1159 PR00010 Type II EGF-like signature

IPR001438 1160 1170 PR00010 Type II EGF-like signature

HMMPfam IPR000372 95 122 PF01462 Cysteine-rich flanking region

IPR001611 124 147 PF00560 Leucine-rich repeat

IPR001611 148 171 PF00560 Leucine-rich repeat

IPR001611 172 193 PF00560 Leucine-rich repeat

IPR001611 196 219 PF00560 Leucine-rich repeat

IPR001611 220 243 PF00560 Leucine-rich repeat

IPR001611 244 267 PF00560 Leucine-rich repeat

IPR000483 301 326 PF01463 Cysteine-rich flanking region

IPR000372 344 371 PF01462 Cysteine-rich flanking region

IPR001611 373 396 PF00560 Leucine-rich repeat

IPR001611 397 420 PF00560 Leucine-rich repeat

IPR001611 421 444 PF00560 Leucine-rich repeat

IPR001611 445 468 PF00560 Leucine-rich repeat

IPR001611 469 492 PF00560 Leucine-rich repeat

IPR000372 569 596 PF01462 Cysteine-rich flanking region

IPR001611 623 646 PF00560 Leucine-rich repeat

IPR001611 671 694 PF00560 Leucine-rich repeat

IPR001611 695 718 PF00560 Leucine-rich repeat

IPR000372 790 817 PF01462 Cysteine-rich flanking region

IPR001611 819 841 PF00560 Leucine-rich repeat

IPR001611 842 865 PF00560 Leucine-rich repeat

IPR001611 866 889 PF00560 Leucine-rich repeat

IPR001611 890 913 PF00560 Leucine-rich repeat

IPR000483 947 972 PF01463 Cysteine-rich flanking region

IPR006209 986 1018 PF00008 EGF-like

IPR006209 1025 1059 PF00008 EGF-like

IPR006209 1066 1097 PF00008 EGF-like

IPR006209 1104 1137 PF00008 EGF-like

IPR006209 1144 1175 PF00008 EGF-like

IPR006209 1189 1220 PF00008 EGF-like

NULL 1189 1220 PF07974 NULL

IPR012679 1252 1383 PF00054 Laminin G

IPR012680 1252 1380 PF02210 Laminin G

IPR006209 1400 1431 PF00008 EGF-like

IPR006209 1439 1470 PF00008 EGF-like

IPR006209 1480 1511 PF00008 EGF-like

HMMSmart IPR000372 95 127 SM00013 Cysteine-rich flanking region

IPR003591 121 145 SM00369 Leucine-rich repeat

NULL 146 168 SM00366 NULL

IPR003591 146 169 SM00369 Leucine-rich repeat

NULL 170 192 SM00366 NULL

IPR003591 170 193 SM00369 Leucine-rich repeat

IPR003591 194 217 SM00369 Leucine-rich repeat

IPR003591 222 241 SM00369 Leucine-rich repeat

NULL 242 264 SM00366 NULL

IPR003591 242 265 SM00369 Leucine-rich repeat

NULL 266 289 SM00366 NULL

IPR000483 277 326 SM00082 Cysteine-rich flanking region

IPR000372 344 376 SM00013 Cysteine-rich flanking region

IPR003591 370 394 SM00369 Leucine-rich repeat

NULL 395 417 SM00366 NULL

IPR003591 395 418 SM00369 Leucine-rich repeat

NULL 419 441 SM00366 NULL

IPR003591 419 442 SM00369 Leucine-rich repeat

IPR003591 443 466 SM00369 Leucine-rich repeat

NULL 467 489 SM00366 NULL

IPR003591 467 490 SM00369 Leucine-rich repeat

IPR000483 502 551 SM00082 Cysteine-rich flanking region

IPR000372 569 601 SM00013 Cysteine-rich flanking region

NULL 621 643 SM00366 NULL

IPR003591 621 644 SM00369 Leucine-rich repeat

IPR003591 669 692 SM00369 Leucine-rich repeat

NULL 693 716 SM00366 NULL

IPR003591 693 716 SM00369 Leucine-rich repeat

IPR000483 728 777 SM00082 Cysteine-rich flanking region

IPR000372 790 822 SM00013 Cysteine-rich flanking region

NULL 818 839 SM00366 NULL

NULL 840 862 SM00366 NULL

IPR003591 840 863 SM00369 Leucine-rich repeat

NULL 864 887 SM00366 NULL

IPR003591 864 887 SM00369 Leucine-rich repeat

NULL 888 910 SM00366 NULL

IPR003591 888 911 SM00369 Leucine-rich repeat

IPR000483 923 972 SM00082 Cysteine-rich flanking region

IPR001881 982 1019 SM00179 EGF-like calcium-binding

IPR006210 985 1019 SM00181 Type I EGF

IPR006210 1024 1060 SM00181 Type I EGF

IPR001881 1025 1060 SM00179 EGF-like calcium-binding

IPR001881 1062 1098 SM00179 EGF-like calcium-binding

IPR006210 1065 1098 SM00181 Type I EGF

IPR001881 1100 1138 SM00179 EGF-like calcium-binding

IPR006210 1103 1138 SM00181 Type I EGF

IPR001881 1140 1176 SM00179 EGF-like calcium-binding

IPR006210 1143 1176 SM00181 Type I EGF

IPR006210 1188 1221 SM00181 Type I EGF

IPR001881 1191 1221 SM00179 EGF-like calcium-binding

IPR001791 1244 1380 SM00282 Laminin G

IPR006210 1399 1432 SM00181 Type I EGF

IPR001881 1400 1432 SM00179 EGF-like calcium-binding

IPR001881 1437 1471 SM00179 EGF-like calcium-binding

IPR006210 1438 1471 SM00181 Type I EGF

IPR001881 1477 1512 SM00179 EGF-like calcium-binding

IPR006210 1479 1512 SM00181 Type I EGF

IPR006207 1523 1592 SM00041 Cystine knot

ProfileScan IPR003591 131 202 PS50506 Leucine-rich repeat

IPR003591 203 274 PS50506 Leucine-rich repeat

IPR003591 380 451 PS50506 Leucine-rich repeat

IPR003591 654 725 PS50506 Leucine-rich repeat

IPR003591 849 920 PS50506 Leucine-rich repeat

NULL 983 1211 PS50311 NULL

IPR000742 986 1018 PS50026 EGF-like

IPR000742 1025 1059 PS50026 EGF-like

NULL 1062 1098 PS50034 NULL

IPR000742 1066 1097 PS50026 EGF-like

NULL 1140 1176 PS50034 NULL

IPR000742 1144 1175 PS50026 EGF-like

IPR001791 1224 1397 PS50025 Laminin G

NULL 1397 1556 PS50311 NULL

IPR006207 1517 1592 PS01225 Cystine knot

ScanRegExp IPR006209 1007 1018 PS00022 EGF-like

IPR006209 1007 1018 PS01186 EGF-like

IPR006209 1048 1059 PS00022 EGF-like

IPR006209 1048 1059 PS01186 EGF-like

IPR001881 1055 1086 PS01187 EGF-like calcium-binding

IPR000152 1077 1088 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 1086 1097 PS00022 EGF-like

IPR006209 1126 1137 PS00022 EGF-like

IPR006209 1126 1137 PS01186 EGF-like

IPR001881 1140 1164 PS01187 EGF-like calcium-binding

IPR000152 1155 1166 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 1164 1175 PS00022 EGF-like

IPR006209 1164 1175 PS01186 EGF-like

IPR006209 1209 1220 PS00022 EGF-like

IPR006209 1209 1220 PS01186 EGF-like

IPR006209 1420 1431 PS00022 EGF-like

IPR006209 1420 1431 PS01186 EGF-like

IPR006209 1459 1470 PS00022 EGF-like

IPR006209 1500 1511 PS00022 EGF-like

IPR006209 1500 1511 PS01186 EGF-like

IPR006207 1555 1591 PS01185 Cystine knot

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	398	411	PR00019	Leucine-rich repeat
IPR001611	621	634	PR00019	Leucine-rich repeat
IPR001438	982	993	PR00010	Type II EGF-like signature
IPR001438	1152	1159	PR00010	Type II EGF-like signature
IPR001438	1160	1170	PR00010	Type II EGF-like signature
HMMPfam	IPR000372	95	122	PF01462	Cysteine-rich flanking region
IPR001611	124	147	PF00560	Leucine-rich repeat
IPR001611	148	171	PF00560	Leucine-rich repeat
IPR001611	172	193	PF00560	Leucine-rich repeat
IPR001611	196	219	PF00560	Leucine-rich repeat
IPR001611	220	243	PF00560	Leucine-rich repeat
IPR001611	244	267	PF00560	Leucine-rich repeat
IPR000483	301	326	PF01463	Cysteine-rich flanking region
IPR000372	344	371	PF01462	Cysteine-rich flanking region
IPR001611	373	396	PF00560	Leucine-rich repeat
IPR001611	397	420	PF00560	Leucine-rich repeat
IPR001611	421	444	PF00560	Leucine-rich repeat
IPR001611	445	468	PF00560	Leucine-rich repeat
IPR001611	469	492	PF00560	Leucine-rich repeat
IPR000372	569	596	PF01462	Cysteine-rich flanking region
IPR001611	623	646	PF00560	Leucine-rich repeat
IPR001611	671	694	PF00560	Leucine-rich repeat
IPR001611	695	718	PF00560	Leucine-rich repeat
IPR000372	790	817	PF01462	Cysteine-rich flanking region
IPR001611	819	841	PF00560	Leucine-rich repeat
IPR001611	842	865	PF00560	Leucine-rich repeat
IPR001611	866	889	PF00560	Leucine-rich repeat
IPR001611	890	913	PF00560	Leucine-rich repeat
IPR000483	947	972	PF01463	Cysteine-rich flanking region
IPR006209	986	1018	PF00008	EGF-like
IPR006209	1025	1059	PF00008	EGF-like
IPR006209	1066	1097	PF00008	EGF-like
IPR006209	1104	1137	PF00008	EGF-like
IPR006209	1144	1175	PF00008	EGF-like
IPR006209	1189	1220	PF00008	EGF-like
NULL	1189	1220	PF07974	NULL
IPR012679	1252	1383	PF00054	Laminin G
IPR012680	1252	1380	PF02210	Laminin G
IPR006209	1400	1431	PF00008	EGF-like
IPR006209	1439	1470	PF00008	EGF-like
IPR006209	1480	1511	PF00008	EGF-like
HMMSmart	IPR000372	95	127	SM00013	Cysteine-rich flanking region
IPR003591	121	145	SM00369	Leucine-rich repeat
NULL	146	168	SM00366	NULL
IPR003591	146	169	SM00369	Leucine-rich repeat
NULL	170	192	SM00366	NULL
IPR003591	170	193	SM00369	Leucine-rich repeat
IPR003591	194	217	SM00369	Leucine-rich repeat
IPR003591	222	241	SM00369	Leucine-rich repeat
NULL	242	264	SM00366	NULL
IPR003591	242	265	SM00369	Leucine-rich repeat
NULL	266	289	SM00366	NULL
IPR000483	277	326	SM00082	Cysteine-rich flanking region
IPR000372	344	376	SM00013	Cysteine-rich flanking region
IPR003591	370	394	SM00369	Leucine-rich repeat
NULL	395	417	SM00366	NULL
IPR003591	395	418	SM00369	Leucine-rich repeat
NULL	419	441	SM00366	NULL
IPR003591	419	442	SM00369	Leucine-rich repeat
IPR003591	443	466	SM00369	Leucine-rich repeat
NULL	467	489	SM00366	NULL
IPR003591	467	490	SM00369	Leucine-rich repeat
IPR000483	502	551	SM00082	Cysteine-rich flanking region
IPR000372	569	601	SM00013	Cysteine-rich flanking region
NULL	621	643	SM00366	NULL
IPR003591	621	644	SM00369	Leucine-rich repeat
IPR003591	669	692	SM00369	Leucine-rich repeat
NULL	693	716	SM00366	NULL
IPR003591	693	716	SM00369	Leucine-rich repeat
IPR000483	728	777	SM00082	Cysteine-rich flanking region
IPR000372	790	822	SM00013	Cysteine-rich flanking region
NULL	818	839	SM00366	NULL
NULL	840	862	SM00366	NULL
IPR003591	840	863	SM00369	Leucine-rich repeat
NULL	864	887	SM00366	NULL
IPR003591	864	887	SM00369	Leucine-rich repeat
NULL	888	910	SM00366	NULL
IPR003591	888	911	SM00369	Leucine-rich repeat
IPR000483	923	972	SM00082	Cysteine-rich flanking region
IPR001881	982	1019	SM00179	EGF-like calcium-binding
IPR006210	985	1019	SM00181	Type I EGF
IPR006210	1024	1060	SM00181	Type I EGF
IPR001881	1025	1060	SM00179	EGF-like calcium-binding
IPR001881	1062	1098	SM00179	EGF-like calcium-binding
IPR006210	1065	1098	SM00181	Type I EGF
IPR001881	1100	1138	SM00179	EGF-like calcium-binding
IPR006210	1103	1138	SM00181	Type I EGF
IPR001881	1140	1176	SM00179	EGF-like calcium-binding
IPR006210	1143	1176	SM00181	Type I EGF
IPR006210	1188	1221	SM00181	Type I EGF
IPR001881	1191	1221	SM00179	EGF-like calcium-binding
IPR001791	1244	1380	SM00282	Laminin G
IPR006210	1399	1432	SM00181	Type I EGF
IPR001881	1400	1432	SM00179	EGF-like calcium-binding
IPR001881	1437	1471	SM00179	EGF-like calcium-binding
IPR006210	1438	1471	SM00181	Type I EGF
IPR001881	1477	1512	SM00179	EGF-like calcium-binding
IPR006210	1479	1512	SM00181	Type I EGF
IPR006207	1523	1592	SM00041	Cystine knot
ProfileScan	IPR003591	131	202	PS50506	Leucine-rich repeat
IPR003591	203	274	PS50506	Leucine-rich repeat
IPR003591	380	451	PS50506	Leucine-rich repeat
IPR003591	654	725	PS50506	Leucine-rich repeat
IPR003591	849	920	PS50506	Leucine-rich repeat
NULL	983	1211	PS50311	NULL
IPR000742	986	1018	PS50026	EGF-like
IPR000742	1025	1059	PS50026	EGF-like
NULL	1062	1098	PS50034	NULL
IPR000742	1066	1097	PS50026	EGF-like
NULL	1140	1176	PS50034	NULL
IPR000742	1144	1175	PS50026	EGF-like
IPR001791	1224	1397	PS50025	Laminin G
NULL	1397	1556	PS50311	NULL
IPR006207	1517	1592	PS01225	Cystine knot
ScanRegExp	IPR006209	1007	1018	PS00022	EGF-like
IPR006209	1007	1018	PS01186	EGF-like
IPR006209	1048	1059	PS00022	EGF-like
IPR006209	1048	1059	PS01186	EGF-like
IPR001881	1055	1086	PS01187	EGF-like calcium-binding
IPR000152	1077	1088	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	1086	1097	PS00022	EGF-like
IPR006209	1126	1137	PS00022	EGF-like
IPR006209	1126	1137	PS01186	EGF-like
IPR001881	1140	1164	PS01187	EGF-like calcium-binding
IPR000152	1155	1166	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	1164	1175	PS00022	EGF-like
IPR006209	1164	1175	PS01186	EGF-like
IPR006209	1209	1220	PS00022	EGF-like
IPR006209	1209	1220	PS01186	EGF-like
IPR006209	1420	1431	PS00022	EGF-like
IPR006209	1420	1431	PS01186	EGF-like
IPR006209	1459	1470	PS00022	EGF-like
IPR006209	1500	1511	PS00022	EGF-like
IPR006209	1500	1511	PS01186	EGF-like
IPR006207	1555	1591	PS01185	Cystine knot

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	715 bp
Genome contig ID	gi65498774f_46647817
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TAGATTATTGATAAATAAAAATTAGTAATAATATG
Flanking genome sequence (420964 - 421013)	----+--------+--------+--------+--------+----* AATTTTTGTTTCTATGAGTTCTAAATATCCCTATACAGTATTCATTTTCA

Gene/Protein Characteristic Table for mKIAA4141

Features of the cloned DNA sequence

Features of the protein sequence