ROUGE

Gene/Protein Characteristic Table for mKIAA0732

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129203
Description :	Telomerase-binding protein EST1A.
Clone Name :	mfj00235 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4414 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1494 bp

Genome contig ID gi65527427f_74555901
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GTTTTGTTTCCTTAATAAATTTTTAGTTATGAAAT
Flanking genome sequence
(334204 - 334253)
----+----*----+----*----+----*----+----*----+----*
ATAATTGACCTCTGCTGGTCTATTTTTTGGGACTGGGGAGGGGCGGCTGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0732 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0732	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2920
Length: 972 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P61406	100.0	Telomerase-bind...	Mus musculus
EDL12790	99.9	Smg-6 homolog, ...	Mus musculus
EDM05197	99.2	similar to Telo...	Rattus norvegicus
XP_001504405	96.4	Smg-6 homolog, ...	Equus caballus
AAO17581	96.3	Est1p-like prot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129101	4.7e-09	23.0	mKIAA0250
AK129286	4.1e-06	23.9	mKIAA1089

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1494 bp
Genome contig ID	gi65527427f_74555901
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTTTTGTTTCCTTAATAAATTTTTAGTTATGAAAT
Flanking genome sequence (334204 - 334253)	----+--------+--------+--------+--------+----* ATAATTGACCTCTGCTGGTCTATTTTTTGGGACTGGGGAGGGGCGGCTGG

Gene/Protein Characteristic Table for mKIAA0732

Features of the cloned DNA sequence

Features of the protein sequence