ROUGE |
Gene/Protein Characteristic Table for mKIAA0646 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172991 |
---|---|
Ubiquitin ligase protein RNF8. | |
mpf01029 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6521 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4269 bp Genome contig ID gi65550231f_27324806 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
CAGAATCTTGGATCATTAAACATATTTTTACTGCTFlanking genome sequence
(188473 - 188522) ----+----*----+----*----+----*----+----*----+----*
CATGTGGCTCTGTGCTGGGCTGCTGTTGTCCACAGTGCTGTGTAACTGAG
KIAA Alignment based on: KIAA0646 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2249
Length: 749 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |