ROUGE

Gene/Protein Characteristic Table for mKIAA0386

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122269
Description :	DJ245M18.1.
Clone Name :	mbg08552 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5528 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2119 bp

Genome contig ID gi65535943f_24018594
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CATGTAAGTCAAAATAAAAATTATTTTTAATTACT
Flanking genome sequence
(195091 - 195140)
----+----*----+----*----+----*----+----*----+----*
AGTCTAGTGTAGAATCTGATATATATTTATTTATCATTTTTATCTGTTAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0386 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0386	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3409
Length: 1135 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q80U16	99.9	Protein FAM65B.	Mus musculus
EDL32492	99.9	RIKEN cDNA 6330...	Mus musculus
XP_002193852	75.0	chromosome 6 op...	Taeniopygia guttata
A9ZLX4	73.5	Protein FAM65B;...	Coturnix japonica
AAP92595	82.4	Ab2-162 [Rattus...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122573	1.3e-57	34.2	mKIAA1930

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 519 565 PS50324 NULL

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	519	565	PS50324	NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 330 352 WDGAETVFLPLIVGFISIKVTEL

Method	From	To	amino acid sequence
SOSUI	330	352	WDGAETVFLPLIVGFISIKVTEL

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2119 bp
Genome contig ID	gi65535943f_24018594
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CATGTAAGTCAAAATAAAAATTATTTTTAATTACT
Flanking genome sequence (195091 - 195140)	----+--------+--------+--------+--------+----* AGTCTAGTGTAGAATCTGATATATATTTATTTATCATTTTTATCTGTTAC

Gene/Protein Characteristic Table for mKIAA0386

Features of the cloned DNA sequence

Features of the protein sequence