HUGE

Gene/Protein Characteristic Table for KIAA1991

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00965
Accession No. :	AB082522
Description :	RING finger protein 169.
HUGO Gene Name :	ring finger protein 169 (RNF169)
Clone Name :	bf00209 [Vector Info]
Flexi ORF Clone :	pF1KSDA1991
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 7811 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5671 bp

Genome contig ID gi51511727f_74037561
PolyA signal sequence
(AGTAAA,-14)
+----*----+----*----+----*----+----
CAAGGCCCAAGTTGAGAATACAGTAAAGGAAACTC
Flanking genome sequence
(193536 - 193585)
----+----*----+----*----+----*----+----*----+----*
ATGAAAGTGGATGTTCTGTTTATAGTCAGAGTCTTGTCTCTGGTGAACAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 74137561 74231095 6 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 712 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_522106	0	99.4	similar to RING...	Pan troglodytes
Q8NCN4	0	100.0	RING finger pro...	Homo sapiens
EAW74948	0	98.9	hCG1644049, iso...	Homo sapiens
XP_001082831	0	96.4	similar to ring...	Macaca mulatta
XP_851632	2e-200	86.5	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 72 110 PF00097 Zinc finger

HMMSmart IPR001841 72 110 SM00184 Zinc finger

ProfileScan IPR001841 72 111 PS50089 Zinc finger

ScanRegExp IPR001841 87 96 PS00518 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	72	110	PF00097	Zinc finger
HMMSmart	IPR001841	72	110	SM00184	Zinc finger
ProfileScan	IPR001841	72	111	PS50089	Zinc finger
ScanRegExp	IPR001841	87	96	PS00518	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAGGGTCAACTCCAGATGCC

Primer_r
: TGGCTCTTCACTTAGGCTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5671 bp
Genome contig ID	gi51511727f_74037561
PolyA signal sequence (AGTAAA,-14)	+--------+--------+----*----+---- CAAGGCCCAAGTTGAGAATACAGTAAAGGAAACTC
Flanking genome sequence (193536 - 193585)	----+--------+--------+--------+--------+----* ATGAAAGTGGATGTTCTGTTTATAGTCAGAGTCTTGTCTCTGGTGAACAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	74137561	74231095	6	99.1	Perfect prediction

Primer_f	: TTAGGGTCAACTCCAGATGCC
Primer_r	: TGGCTCTTCACTTAGGCTCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1991

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information