HUGE

Gene/Protein Characteristic Table for KIAA1952

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07502
Accession No. :	AB075832
Description :	Zinc finger protein 618.
HUGO Gene Name :	zinc finger protein 618 (ZNF618)
Clone Name :	fj14047 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 2894 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 16 bp

Genome contig ID gi89161216f_115730022
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAAATCCAACATGCTTTAAGACTTGACTTCGGGGG
Flanking genome sequence
(122264 - 122313)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAGAGAAGATAACATTAGAAAAAAACCACACAACACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 115830022 115852284 6 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 735 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5T7W0	1.7e-214	94.4	Zinc finger pro...	Homo sapiens
NP_588615	3.6e-214	95.5	zinc finger pro...	Homo sapiens
AAH53892	3.6e-214	95.5	Zinc finger pro...	Homo sapiens
XP_001145280	6.4e-214	94.3	zinc finger pro...	Pan troglodytes
XP_001097368	1.2e-213	94.2	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008906 654 734 PF05699 HAT dimerisation

ProfileScan IPR007087 173 200 PS50157 Zinc finger

ScanRegExp IPR007087 175 195 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008906	654	734	PF05699	HAT dimerisation
ProfileScan	IPR007087	173	200	PS50157	Zinc finger
ScanRegExp	IPR007087	175	195	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACACCCAACAGCATGATCCC

Primer_r
: CCCAGGATTTCAGTGACCGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	16 bp
Genome contig ID	gi89161216f_115730022
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAATCCAACATGCTTTAAGACTTGACTTCGGGGG
Flanking genome sequence (122264 - 122313)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAGAGAAGATAACATTAGAAAAAAACCACACAACACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	115830022	115852284	6	99.6	Perfect prediction

Primer_f	: AACACCCAACAGCATGATCCC
Primer_r	: CCCAGGATTTCAGTGACCGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1952

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information