HUGE

Gene/Protein Characteristic Table for KIAA1643

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB046863
Description :	Zinc finger FYVE domain-containing protein 28.
HUGO Gene Name :	zinc finger, FYVE domain containing 28 (ZFYVE28)
Clone Name :	hh10131 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5503 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1127 bp

Genome contig ID gi89161207r_2141123
PolyA signal sequence
(CATAAA,-22)
+----*----+----*----+----*----+----
TTGAAGCCATTTCCATAAATCTATTTAAGGATTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGACGCTCTCCTTTCTTCCATGAACGCGGATCTTTTTTCTCTGTCTGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 2241123 2390167 13 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 993 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCC9	100.0	Zinc finger FYV...	Homo sapiens
EAW82529	99.9	zinc finger, FY...	Homo sapiens
EAW82528	95.7	zinc finger, FY...	Homo sapiens
BAH11908	99.8	unnamed protein...	Homo sapiens
BAH14855	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002369	3.9e-05	24.4	KIAA0371
AB037783	5.8e-05	28.2	KIAA1362
AB040970	0.00032	30.3	KIAA1537
AB046809	0.00073	38.8	KIAA1589
AB023210	0.0008	43.3	KIAA0993

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000306 918 984 PF01363 Zinc finger

HMMSmart IPR000306 915 984 SM00064 Zinc finger

ProfileScan IPR000306 923 979 PS50178 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000306	918	984	PF01363	Zinc finger
HMMSmart	IPR000306	915	984	SM00064	Zinc finger
ProfileScan	IPR000306	923	979	PS50178	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTGCTGGGGCTATGGGAATC

Primer_r
: GGCTTCCAGATTCACCGCAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: RH-map
Primer_f	: TCTGCTGGGGCTATGGGAATC
Primer_r	: GGCTTCCAGATTCACCGCAAC
PCR product length	: 92 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1127 bp
Genome contig ID	gi89161207r_2141123
PolyA signal sequence (CATAAA,-22)	+--------+--------+----*----+---- TTGAAGCCATTTCCATAAATCTATTTAAGGATTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGACGCTCTCCTTTCTTCCATGAACGCGGATCTTTTTTCTCTGTCTGGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	2241123	2390167	13	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1643

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information