HUGE

Gene/Protein Characteristic Table for KIAA1625

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00259
Accession No. :	AB046845
Description :	E3 ubiquitin-protein ligase SMURF1.
HUGO Gene Name :	SMAD specific E3 ubiquitin protein ligase 1 (SMURF1)
Clone Name :	hh15184 [Vector Info]
Flexi ORF Clone :	pF1KA1625
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5725 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3143 bp

Genome contig ID gi89161213r_98363000
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TCATTTTGTTACATATGCAATAAACTCACGACTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATTTTTGGCGTCTGTTATTTTGGTGTGGAAATGAGATTCTAGTGTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 98463000 98579659 19 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 859 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCE7	0	100.0	E3 ubiquitin-pr...	Homo sapiens
XP_528043	0	99.6	Smad ubiquitina...	Pan troglodytes
EAW76686	0	100.0	SMAD specific E...	Homo sapiens
XP_001510726	3.6e-202	72.9	hypothetical pr...	Ornithorhynchus...
XP_511577	1.7e-201	68.4	SMAD specific E...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007899	3.9e-55	44.2	KIAA0439
D42055	8.4e-55	45.4	KIAA0093
AB037722	5e-50	45.9	KIAA1301
AB002320	3.2e-49	46.9	KIAA0322
AB002310	2.5e-44	45.5	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 117 201 PF00168 C2 calcium-dependent membrane targeting

IPR001202 338 367 PF00397 WW/Rsp5/WWP

IPR001202 410 439 PF00397 WW/Rsp5/WWP

IPR000569 551 859 PF00632 HECT

HMMSmart IPR000008 116 219 SM00239 C2 calcium-dependent membrane targeting

IPR001202 337 369 SM00456 WW/Rsp5/WWP

IPR001202 409 441 SM00456 WW/Rsp5/WWP

IPR000569 520 859 SM00119 HECT

ProfileScan IPR000008 116 201 PS50004 C2 calcium-dependent membrane targeting

IPR001202 336 369 PS50020 WW/Rsp5/WWP

IPR001202 408 441 PS50020 WW/Rsp5/WWP

IPR000569 522 859 PS50237 HECT

ScanRegExp IPR001202 414 439 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	117	201	PF00168	C2 calcium-dependent membrane targeting
IPR001202	338	367	PF00397	WW/Rsp5/WWP
IPR001202	410	439	PF00397	WW/Rsp5/WWP
IPR000569	551	859	PF00632	HECT
HMMSmart	IPR000008	116	219	SM00239	C2 calcium-dependent membrane targeting
IPR001202	337	369	SM00456	WW/Rsp5/WWP
IPR001202	409	441	SM00456	WW/Rsp5/WWP
IPR000569	520	859	SM00119	HECT
ProfileScan	IPR000008	116	201	PS50004	C2 calcium-dependent membrane targeting
IPR001202	336	369	PS50020	WW/Rsp5/WWP
IPR001202	408	441	PS50020	WW/Rsp5/WWP
IPR000569	522	859	PS50237	HECT
ScanRegExp	IPR001202	414	439	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAGATAATGAAGATGCGACC

Primer_r
: CTGGAAGAGCCCGTAATAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3143 bp
Genome contig ID	gi89161213r_98363000
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TCATTTTGTTACATATGCAATAAACTCACGACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATTTTTGGCGTCTGTTATTTTGGTGTGGAAATGAGATTCTAGTGTCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	98463000	98579659	19	99.7	Perfect prediction

Primer_f	: CCAGATAATGAAGATGCGACC
Primer_r	: CTGGAAGAGCCCGTAATAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1625

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information