HUGE

Gene/Protein Characteristic Table for KIAA1607

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04305
Accession No. :	AB046827
Description :	Uncharacterized protein C10orf64.
HUGO Gene Name :	WDFY family member 4 (WDFY4)
Clone Name :	fj11118 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4191 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 376 bp

Genome contig ID gi89161187f_49599144
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
GTATTGTCTTTATTTTATTAAAGCAACTATGTTTT
Flanking genome sequence
(261858 - 261907)
----+----*----+----*----+----*----+----*----+----*
AAATGCAGAAGGGCTCTTCAGTTTTAAACTGCCACTCTATTCCACTTACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 49699144 49861000 29 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1270 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW93118	100.0	hCG1745555, iso...	Homo sapiens
Q6ZS81	99.8	Protein WDFY4.	Homo sapiens
XP_001113742	96.6	similar to WD r...	Macaca mulatta
BAB84911	98.0	FLJ00156 protei...	Homo sapiens
XP_001926773	86.3	similar to WD r...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023210	5.3e-68	38.6	KIAA0993
AB011112	5.1e-56	30.0	KIAA0540
AB046764	4e-55	38.3	KIAA1544

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 1064 1097 PD000018 WD40 repeat

FPrintScan IPR001680 1034 1048 PR00320 WD40 repeat

IPR001680 1083 1097 PR00320 WD40 repeat

IPR001680 1173 1187 PR00320 WD40 repeat

HMMPfam IPR000409 625 907 PF02138 Beige/BEACH

IPR001680 1058 1096 PF00400 WD40 repeat

IPR001680 1100 1137 PF00400 WD40 repeat

IPR001680 1143 1186 PF00400 WD40 repeat

HMMSmart IPR001680 1007 1047 SM00320 WD40 repeat

IPR001680 1057 1096 SM00320 WD40 repeat

IPR001680 1099 1137 SM00320 WD40 repeat

IPR001680 1139 1186 SM00320 WD40 repeat

IPR001680 1232 1267 SM00320 WD40 repeat

ProfileScan IPR000409 613 907 PS50197 Beige/BEACH

IPR001680 1064 1105 PS50082 WD40 repeat

IPR001680 1064 1195 PS50294 WD40 repeat

IPR001680 1170 1195 PS50082 WD40 repeat

ScanRegExp IPR001680 1083 1097 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	1064	1097	PD000018	WD40 repeat
FPrintScan	IPR001680	1034	1048	PR00320	WD40 repeat
IPR001680	1083	1097	PR00320	WD40 repeat
IPR001680	1173	1187	PR00320	WD40 repeat
HMMPfam	IPR000409	625	907	PF02138	Beige/BEACH
IPR001680	1058	1096	PF00400	WD40 repeat
IPR001680	1100	1137	PF00400	WD40 repeat
IPR001680	1143	1186	PF00400	WD40 repeat
HMMSmart	IPR001680	1007	1047	SM00320	WD40 repeat
IPR001680	1057	1096	SM00320	WD40 repeat
IPR001680	1099	1137	SM00320	WD40 repeat
IPR001680	1139	1186	SM00320	WD40 repeat
IPR001680	1232	1267	SM00320	WD40 repeat
ProfileScan	IPR000409	613	907	PS50197	Beige/BEACH
IPR001680	1064	1105	PS50082	WD40 repeat
IPR001680	1064	1195	PS50294	WD40 repeat
IPR001680	1170	1195	PS50082	WD40 repeat
ScanRegExp	IPR001680	1083	1097	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTCTTCTACAACAATGATCGG

Primer_r
: TGCTGATGTCCCTTTTCTGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: CCR
Primer_f	: CAGAAGGATTTGGATTGGAGC
Primer_r	: GTCTGCACTGTCTTCTGGATG
PCR product length	: 145(1.6k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	376 bp
Genome contig ID	gi89161187f_49599144
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GTATTGTCTTTATTTTATTAAAGCAACTATGTTTT
Flanking genome sequence (261858 - 261907)	----+--------+--------+--------+--------+----* AAATGCAGAAGGGCTCTTCAGTTTTAAACTGCCACTCTATTCCACTTACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	49699144	49861000	29	99.8	Perfect prediction

Primer_f	: GTCTTCTACAACAATGATCGG
Primer_r	: TGCTGATGTCCCTTTTCTGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1607

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information