HUGE

Gene/Protein Characteristic Table for KIAA1268

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06272
Accession No. :	AB033094
Description :	Poly [ADP-ribose] polymerase 14.
HUGO Gene Name :	poly (ADP-ribose) polymerase family, member 14 (PARP14)
Clone Name :	hj07379 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5231 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2159 bp

Genome contig ID gi89161205f_123802063
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTAAGGTGCCTCCATGGAGGTCCCTAGAATTGTG
Flanking genome sequence
(122123 - 122172)
----+----*----+----*----+----*----+----*----+----*
AAAATAACATAAAAAATGGGTGGTCTGTCATCCTCTATGACTATTATGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 123902063 123924184 10 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1023 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAY64450	100.0	B-aggressive ly...	Homo sapiens
EAW79467	99.9	poly (ADP-ribos...	Homo sapiens
EAW79470	99.1	poly (ADP-ribos...	Homo sapiens
AAY64449	99.1	B-aggressive ly...	Homo sapiens
Q460N5	99.1	Poly [ADP-ribos...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002589 163 280 PF01661 Appr-1-p processing

IPR002589 375 491 PF01661 Appr-1-p processing

IPR002589 588 690 PF01661 Appr-1-p processing

IPR004170 866 944 PF02825 WWE

HMMSmart IPR002589 146 280 SM00506 Appr-1-p processing

IPR002589 358 491 SM00506 Appr-1-p processing

IPR002589 571 690 SM00506 Appr-1-p processing

ProfileScan IPR002589 134 321 PS51154 Appr-1-p processing

IPR002589 346 533 PS51154 Appr-1-p processing

IPR002589 559 730 PS51154 Appr-1-p processing

IPR004170 866 944 PS50918 WWE

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002589	163	280	PF01661	Appr-1-p processing
IPR002589	375	491	PF01661	Appr-1-p processing
IPR002589	588	690	PF01661	Appr-1-p processing
IPR004170	866	944	PF02825	WWE
HMMSmart	IPR002589	146	280	SM00506	Appr-1-p processing
IPR002589	358	491	SM00506	Appr-1-p processing
IPR002589	571	690	SM00506	Appr-1-p processing
ProfileScan	IPR002589	134	321	PS51154	Appr-1-p processing
IPR002589	346	533	PS51154	Appr-1-p processing
IPR002589	559	730	PS51154	Appr-1-p processing
IPR004170	866	944	PS50918	WWE

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAACTTGAACACATACACTGC

Primer_r
: CTGATTAAACTTGCTTGCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAACTTGAACACATACACTGC
Primer_r	: CTGATTAAACTTGCTTGCCAC
PCR product length	: 181(1.6k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2159 bp
Genome contig ID	gi89161205f_123802063
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAAGGTGCCTCCATGGAGGTCCCTAGAATTGTG
Flanking genome sequence (122123 - 122172)	----+--------+--------+--------+--------+----* AAAATAACATAAAAAATGGGTGGTCTGTCATCCTCTATGACTATTATGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	123902063	123924184	10	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1268

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information