HUGE

Gene/Protein Characteristic Table for KIAA1002

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00163
Accession No. :	AB023219
Description :	R3H domain-containing protein 2.
HUGO Gene Name :	R3H domain containing 2 (R3HDM2)
Clone Name :	hk09859 [Vector Info]
Flexi ORF Clone :	pF1KA1002
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4331 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1008 bp

Genome contig ID gi89161190r_55833908
PolyA signal sequence
(TATAAA,-25)
+----*----+----*----+----*----+----
TGTTTTTAAATATAAAAAAAAAAATCTGTCACTGG
Flanking genome sequence
(99907 - 99858)
----+----*----+----*----+----*----+----*----+----*
ACATCAGTCACTGTTTCTCTGTTGCCGCCCTGGTATGGGTAAAGGGTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 55933815 56111055 24 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 962 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2K5	0	99.7	R3H domain-cont...	Homo sapiens
XP_001488702	0	96.9	R3H domain cont...	Equus caballus
XP_001100250	0	99.6	hypothetical pr...	Macaca mulatta
BAG10408	0	100.0	R3H domain-cont...	synthetic construct
EAW97008	1.5e-206	100.0	R3H domain cont...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D21852	8e-20	49.6	KIAA0029

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001374 162 215 PF01424 Single-stranded nucleic acid binding R3H

HMMSmart IPR001374 138 215 SM00393 Single-stranded nucleic acid binding R3H

ProfileScan IPR001374 155 218 PS51061 Single-stranded nucleic acid binding R3H

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001374	162	215	PF01424	Single-stranded nucleic acid binding R3H
HMMSmart	IPR001374	138	215	SM00393	Single-stranded nucleic acid binding R3H
ProfileScan	IPR001374	155	218	PS51061	Single-stranded nucleic acid binding R3H

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCCCCATCTTGTCTTCCTAG

Primer_r
: CAGTGAATATACCCAGCAAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: CCR
Primer_f	: TTCCCCATCTTGTCTTCCTAG
Primer_r	: CAGTGAATATACCCAGCAAAC
PCR product length	: 155 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1008 bp
Genome contig ID	gi89161190r_55833908
PolyA signal sequence (TATAAA,-25)	+--------+--------+----*----+---- TGTTTTTAAATATAAAAAAAAAAATCTGTCACTGG
Flanking genome sequence (99907 - 99858)	----+--------+--------+--------+--------+----* ACATCAGTCACTGTTTCTCTGTTGCCGCCCTGGTATGGGTAAAGGGTTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	55933815	56111055	24	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1002

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information