HUGE

Gene/Protein Characteristic Table for KIAA0662

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00596
Accession No. :	AB014562
Description :	PHD finger protein 2.
HUGO Gene Name :	PHD finger protein 2 (PHF2)
Clone Name :	hk01953s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0662
Source :	Human adult brain
Note :	We replaced hk01953, former representative clones for KIAA0662 with hk01953s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5253 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1907 bp

Genome contig ID gi89161216f_95278853
PolyA signal sequence
(AGTAAA,-25)
+----*----+----*----+----*----+----
GTTTTAAAAAAGTAAAAATATTTCAGGTTTTGTAC
Flanking genome sequence
(202835 - 202884)
----+----*----+----*----+----*----+----*----+----*
AGAACCATGTCTGTGTCATTTCTGCCTCGACTGTAGTTGTTCACCCTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 95378853 95481686 22 99.3 Both No-hit

Features of the protein sequence	Description

Length: 1114 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09802	100.0	PHD finger prot...	synthetic construct
CAD38938	97.8	hypothetical pr...	Homo sapiens
O75151	97.4	PHD finger prot...	Homo sapiens
EAW62868	97.3	PHD finger prot...	Homo sapiens
EAW62869	99.3	PHD finger prot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029034	6.5e-46	46.2	KIAA1111
AB023221	7.1e-10	33.1	KIAA1004

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013129 249 349 PF02373 Transcription factor jumonji

HMMSmart IPR003347 210 366 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

ProfileScan IPR003347 210 366 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	249	349	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	210	366	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	210	366	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTTACGGTCGGCACTTCTCTG

Primer_r
: AGAAACAAATCCAGCCCCTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTACGGTCGGCACTTCTCTG
Primer_r	: AGAAACAAATCCAGCCCCTCC
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1907 bp
Genome contig ID	gi89161216f_95278853
PolyA signal sequence (AGTAAA,-25)	+--------+--------+----*----+---- GTTTTAAAAAAGTAAAAATATTTCAGGTTTTGTAC
Flanking genome sequence (202835 - 202884)	----+--------+--------+--------+--------+----* AGAACCATGTCTGTGTCATTTCTGCCTCGACTGTAGTTGTTCACCCTGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	95378853	95481686	22	99.3	Both No-hit

Gene/Protein Characteristic Table for KIAA0662

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information