HUGE

Gene/Protein Characteristic Table for KIAA0600

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01982
Accession No. :	AB011172
Description :	Histone deacetylase 5.
HUGO Gene Name :	histone deacetylase 5 (HDAC5)
Clone Name :	fh08981 [Vector Info]
Flexi ORF Clone :	pF1KA0600
Source :	Human fetal brain
Note :	We replaced hg00785a, former representative clones for KIAA0600 with fh08981. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5040 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1622 bp

Genome contig ID gi51511734r_39409648
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGTCCTTGTGTAAATAAACTTGTTTCTGGCAGTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTCTGGGGCCAATGTCTCTATTCTCTGGGCTCCCAAATGGAGTAGAGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 39509648 39556512 25 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1080 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG72583	0	100.0	histone deacety...	synthetic construct
CAM25071	0	94.7	histone deacety...	Mus musculus
BAG57895	8.6e-198	90.2	unnamed protein...	Homo sapiens
NP_005465	1e-197	92.4	histone deacety...	Homo sapiens
EAW51633	1.6e-197	90.1	histone deacety...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006626	9.9e-44	52.9	KIAA0288
AB018287	3e-31	50.5	KIAA0744
AB020708	2.3e-15	46.9	KIAA0901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000286 787 810 PR01270 Histone deacetylase superfamily

IPR000286 821 836 PR01270 Histone deacetylase superfamily

IPR000286 912 922 PR01270 Histone deacetylase superfamily

HMMPfam IPR000286 642 986 PF00850 Histone deacetylase superfamily

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000286	787	810	PR01270	Histone deacetylase superfamily
IPR000286	821	836	PR01270	Histone deacetylase superfamily
IPR000286	912	922	PR01270	Histone deacetylase superfamily
HMMPfam	IPR000286	642	986	PF00850	Histone deacetylase superfamily

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTCGGCTCTGCTCAGTGTAG

Primer_r
: TTTGCTCTGGATCTCGATGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCACTCTGAATACCACACCC
Primer_r	: CCACAAGGCAGCACAGCATAC
PCR product length	: 118 (1.0k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1622 bp
Genome contig ID	gi51511734r_39409648
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTCCTTGTGTAAATAAACTTGTTTCTGGCAGTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTCTGGGGCCAATGTCTCTATTCTCTGGGCTCCCAAATGGAGTAGAGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	39509648	39556512	25	99.7	Perfect prediction

Primer_f	: TCTCGGCTCTGCTCAGTGTAG
Primer_r	: TTTGCTCTGGATCTCGATGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0600

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information