| HUGE |
Gene/Protein Characteristic Table for KIAA0600 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01982 |
|---|---|
| Accession No. : | AB011172 |
| Description : | Histone deacetylase 5. |
| HUGO Gene Name : | histone deacetylase 5 (HDAC5) |
| Clone Name : | fh08981 [Vector Info] |
| Flexi ORF Clone : | pF1KA0600
![]() |
| Source : | Human fetal brain |
| Note : | We replaced hg00785a, former representative clones for KIAA0600 with fh08981. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5040 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1622 bp Genome contig ID gi51511734r_39409648 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TGTCCTTGTGTAAATAAACTTGTTTCTGGCAGTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CTTCTGGGGCCAATGTCTCTATTCTCTGGGCTCCCAAATGGAGTAGAGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 39509648 39556512 25 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1080 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TCTCGGCTCTGCTCAGTGTAG | |
| : TTTGCTCTGGATCTCGATGAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : GeneBridge 4 | |
| : TGCACTCTGAATACCACACCC | |
| : CCACAAGGCAGCACAGCATAC | |
| : 118 (1.0k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |