HUGE

Gene/Protein Characteristic Table for KIAA0563

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00098
Accession No. :	AB011135
Description :	Leucine-rich repeat-containing protein 37A.
HUGO Gene Name :	leucine rich repeat containing 37, member A3 (LRRC37A3)
Clone Name :	fh23589 [Vector Info]
Flexi ORF Clone :	pF1KA0563
Source :	Human fetal brain
Note :	We replaced hh01806, former representative clones for KIAA0563 with fh23589. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 5665 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 229 bp

Genome contig ID gi51511734r_60180950
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TGGAGATTTTACAATTAAATAACATTGTTTTTGGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GCCCTCTCCCTTGGTTCATCAAGCACCAGTCATATAATACCACATACTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 60280950 60345365 14 99.7 Perfect prediction

ContigView(URL based/DAS) 17 f 41705170 41770901 14 98.1 Terminal No-hit

ContigView(URL based/DAS) 17 f 41923846 41988315 14 98.2 Terminal No-hit

Features of the protein sequence	Description

Length: 1652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60309	100.0	Leucine-rich re...	Homo sapiens
AAH43145	99.8	Leucine rich re...	Homo sapiens
A6NM11	97.5	Leucine-rich re...	Homo sapiens
A6NMS7	97.4	Leucine-rich re...	Homo sapiens
AAH40501	97.0	Leucine rich re...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79992	0.00067	22.8	KIAA0170

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 933 946 PR00019 Leucine-rich repeat

IPR001611 954 967 PR00019 Leucine-rich repeat

HMMPfam IPR001611 932 954 PF00560 Leucine-rich repeat

IPR001611 956 978 PF00560 Leucine-rich repeat

IPR001611 983 1005 PF00560 Leucine-rich repeat

HMMSmart IPR003591 910 929 SM00369 Leucine-rich repeat

IPR003591 930 953 SM00369 Leucine-rich repeat

IPR003591 954 977 SM00369 Leucine-rich repeat

IPR003591 981 1005 SM00369 Leucine-rich repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	933	946	PR00019	Leucine-rich repeat
IPR001611	954	967	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	932	954	PF00560	Leucine-rich repeat
IPR001611	956	978	PF00560	Leucine-rich repeat
IPR001611	983	1005	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	910	929	SM00369	Leucine-rich repeat
IPR003591	930	953	SM00369	Leucine-rich repeat
IPR003591	954	977	SM00369	Leucine-rich repeat
IPR003591	981	1005	SM00369	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 29 CVMSPLRFWGPWPLLMWQLLWLL 51 SECONDARY 23

2 1600 LILALIVTGILTILIILLCLIEI 1622 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	29	CVMSPLRFWGPWPLLMWQLLWLL	51	SECONDARY	23
2	1600	LILALIVTGILTILIILLCLIEI	1622	PRIMARY	23

RH mapping information	Description

Chromosome No.

Experimental conditions

Panel name	:
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	229 bp
Genome contig ID	gi51511734r_60180950
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TGGAGATTTTACAATTAAATAACATTGTTTTTGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCCCTCTCCCTTGGTTCATCAAGCACCAGTCATATAATACCACATACTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	60280950	60345365	14	99.7	Perfect prediction
ContigView(URL based/DAS)	17	f	41705170	41770901	14	98.1	Terminal No-hit
ContigView(URL based/DAS)	17	f	41923846	41988315	14	98.2	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0563

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information