HUGE

Gene/Protein Characteristic Table for KIAA0522

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05530
Accession No. :	AB011094
Description :	IQ motif and Sec7 domain-containing protein 2.
HUGO Gene Name :	IQ motif and Sec7 domain 2 (IQSEC2)
Clone Name :	hg01393 [Vector Info]
Flexi ORF Clone :	pF1KA0522
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6022 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1354 bp

Genome contig ID gi89161218r_53178784
PolyA signal sequence
(CATAAA,-31)
+----*----+----*----+----*----+----
GCCTCATAAAAGACCTTGTGCTCAAAAAAAAAAAC
Flanking genome sequence
(288464 - 288415)
----+----*----+----*----+----*----+----*----+----*
CTAAGGCCCCTGCCTTATTAATGATAGAGAGCAGAGAGGGAAGAGAGGTA

Features of the protein sequence	Description

Length: 1555 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW93147	100.0	hCG19160 [Homo ...	Homo sapiens
Q5JU85	99.3	IQ motif and SE...	Homo sapiens
Q5DU25	98.3	IQ motif and SE...	Mus musculus
BAF49453	98.4	ARF6 guanine nu...	Mus musculus
XP_001914847	95.8	similar to IQ m...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029033	1.9e-31	44.0	KIAA1110
AB018306	5.6e-30	62.5	KIAA0763
D87435	4e-05	34.6	KIAA0248

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000048 415 435 PF00612 IQ calmodulin-binding region

IPR000904 817 1008 PF01369 SEC7-like

HMMSmart IPR000904 817 1008 SM00222 SEC7-like

IPR001849 1039 1150 SM00233 Pleckstrin-like

ProfileScan IPR000048 414 443 PS50096 IQ calmodulin-binding region

IPR000904 813 1006 PS50190 SEC7-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	415	435	PF00612	IQ calmodulin-binding region
IPR000904	817	1008	PF01369	SEC7-like
HMMSmart	IPR000904	817	1008	SM00222	SEC7-like
IPR001849	1039	1150	SM00233	Pleckstrin-like
ProfileScan	IPR000048	414	443	PS50096	IQ calmodulin-binding region
IPR000904	813	1006	PS50190	SEC7-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAGCACAAGGTCTTTTATGAG

Primer_r
: ATGGACCCTGGCTGTACGAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGCACAAGGTCTTTTATGAG
Primer_r	: ATGGACCCTGGCTGTACGAAG
PCR product length	: 164 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1354 bp
Genome contig ID	gi89161218r_53178784
PolyA signal sequence (CATAAA,-31)	+--------+--------+----*----+---- GCCTCATAAAAGACCTTGTGCTCAAAAAAAAAAAC
Flanking genome sequence (288464 - 288415)	----+--------+--------+--------+--------+----* CTAAGGCCCCTGCCTTATTAATGATAGAGAGCAGAGAGGGAAGAGAGGTA

Gene/Protein Characteristic Table for KIAA0522

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information