| HUGE |
Gene/Protein Characteristic Table for KIAA0481 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00088 |
|---|---|
| Accession No. : | AB007950 |
| Description : | Transmembrane and coiled-coil domains protein 2. |
| HUGO Gene Name : | |
| Clone Name : | hm00132 [Vector Info] |
| Flexi ORF Clone : | pF1KA0481
![]() |
| Source : | Human adult brain |
| Note : | We replaced hh01480 and hh01480s1, former representative clones for KIAA0481 with hm00132. (2002/5/10,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3998 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1213 bp Genome contig ID gi89161185f_203363661 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CACCTTCCTGAGAAATAAATATCCTCTAAATTTTCFlanking genome sequence
(145429 - 145478) ----+----*----+----*----+----*----+----*----+----*
AAACCATCCTGTCTGGTGTTGGTTGATTAGGTTGTGTCTGTGGGAACCAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 203463661 203509088 5 99.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 732 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| SOSUI2 | 1 | 667 | GKFINVILALMAVLLVFVSTIAN | 689 | PRIMARY | 23 |
| 2 | 705 | TLLVLVLFLLWKHWDSLTYLLEH | 727 | SECONDARY | 23 |
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : CTCAGGAAGGTGCACAACAGC | |
| : GCTCTGGAGTGTTGTGTATGG | |
| : 146 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |