HUGE

Gene/Protein Characteristic Table for KIAA0459

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00081
Accession No. :	AB007928
Description :	OTU domain-containing protein 3.
HUGO Gene Name :	OTU domain containing 3 (OTUD3)
Clone Name :	fg05396 [Vector Info]
Flexi ORF Clone :	pF1KA0459
Source :	Human fetal brain
Note :	We replaced hg00766, former representative clones for KIAA0459 with fg05396. (1998/8/13)

Features of the cloned DNA sequence	Description

Length: 6489 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 5196 bp

Genome contig ID gi89161185f_19981498
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GAGTTTTGTATACCAATAAATTCTAGTTTAAAAAC
Flanking genome sequence
(130526 - 130575)
----+----*----+----*----+----*----+----*----+----*
AAAGTTTTAAGTTGTTTTTATCAGTATCTGACCACCGTTTGAGTGAATGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 20081497 20112022 8 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 430 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_513073	1.2e-164	99.1	OTU domain cont...	Pan troglodytes
XP_001107780	5.1e-160	97.0	OTU domain cont...	Macaca mulatta
Q5T2D3	2.7e-151	100.0	OTU domain-cont...	Homo sapiens
BAE90570	5.8e-148	98.0	unnamed protein...	Macaca fascicularis
XP_131770	5.8e-124	79.6	OTU domain cont...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003323 103 215 PF02338 Ovarian tumour

ProfileScan IPR003323 97 221 PS50802 Ovarian tumour

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003323	103	215	PF02338	Ovarian tumour
ProfileScan	IPR003323	97	221	PS50802	Ovarian tumour

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACAATCTAGGGGGAAGGAAC
Primer_r	: GATACTTAAGACCTCCATGGG
PCR product length	: 124 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	5196 bp
Genome contig ID	gi89161185f_19981498
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAGTTTTGTATACCAATAAATTCTAGTTTAAAAAC
Flanking genome sequence (130526 - 130575)	----+--------+--------+--------+--------+----* AAAGTTTTAAGTTGTTTTTATCAGTATCTGACCACCGTTTGAGTGAATGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	20081497	20112022	8	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0459

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information